RchiOBHm_Chr5g0024111

Aminotransferase class-V

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0005210
Physical Location & Seq
Forward (+)
18304148 .. 18304339
192 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30389

Sequence Viewer

Length: 192 bp
ATGGCATCCTCCCCCAACCACACCCTCAACAGTGATTCAAACACCCACGCCTCCAAAAAGTCCAAACTTTTCTTCATTACCCCTTCCGAAATCATTGCCGAATTCTCCCACCACGACCCCAACGTCGCCCGGATCAACAACGGCAGCTTCGGGTCCTGCCCAGACTCCATCATCCAGGCCCAGCGCTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00270 map00270
Pfam Domains
Protein Families
Aminotran_5

Protein Analysis

63

Amino Acids

6.86

Weight (kDa)

6.89

Isoelectric Point (pI)

37.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 122
AclWI GGATC 1 cut(s) 140
AcsI RAATTY 1 cut(s) 101
AfeI AGCGCT 1 cut(s) 185
AgsI TTSAA 1 cut(s) 39
AjnI CCWGG 1 cut(s) 174
AjuI GAANNNNNNNTTGG 2 cut(s) 56, 88
AluBI AGCT 1 cut(s) 147
AluI AGCT 1 cut(s) 147
AlwI GGATC 1 cut(s) 140
Aor51HI AGCGCT 1 cut(s) 185
AoxI GGCC 1 cut(s) 177
ApeKI GCWGC 2 cut(s) 144, 186
ApoI RAATTY 1 cut(s) 101
AspLEI GCGC 1 cut(s) 186
AspS9I GGNCC 2 cut(s) 153, 178
AsuC2I CCSGG 1 cut(s) 130
AvaII GGWCC 1 cut(s) 153
BbvI GCAGC 2 cut(s) 156, 173
BccI CCATC 1 cut(s) 176
BceAI ACGGC 1 cut(s) 157
BcgI CGANNNNNNTGC 2 cut(s) 77, 111
BciT130I CCWGG 1 cut(s) 176
BcnI CCSGG 1 cut(s) 130
BfaI CTAG 1 cut(s) 190
BfoI RGCGCY 1 cut(s) 187
BisI GCNGC 2 cut(s) 145, 187
BlsI GCNGC 2 cut(s) 146, 188
Bme1390I CCNGG 2 cut(s) 130, 176
Bme18I GGWCC 1 cut(s) 153
BmgT120I GGNCC 2 cut(s) 153, 178
BmiI GGNNCC 1 cut(s) 154
BmrFI CCNGG 2 cut(s) 130, 176
BmsI GCATC 1 cut(s) 14
BpuMI CCSGG 1 cut(s) 130
Bse3DI GCAATG 1 cut(s) 93
BseBI CCWGG 1 cut(s) 176
BseGI GGATG 2 cut(s) 5, 171
BseMI GCAATG 1 cut(s) 93
BseXI GCAGC 2 cut(s) 156, 173
BseYI CCCAGC 1 cut(s) 180
BshFI GGCC 1 cut(s) 179
BsiSI CCGG 1 cut(s) 130
BsnI GGCC 1 cut(s) 179
Bsp143I GATC 1 cut(s) 132
BspANI GGCC 1 cut(s) 179
BspLI GGNNCC 1 cut(s) 154
BspPI GGATC 1 cut(s) 140
BsrDI GCAATG 1 cut(s) 93
BssMI GATC 1 cut(s) 132
Bst2UI CCWGG 1 cut(s) 176
Bst4CI ACNGT 1 cut(s) 32
BstF5I GGATG 2 cut(s) 5, 171
BstH2I RGCGCY 1 cut(s) 187
BstHHI GCGC 1 cut(s) 186
BstKTI GATC 1 cut(s) 135
BstMBI GATC 1 cut(s) 132
BstNI CCWGG 1 cut(s) 176
BstSCI CCNGG 2 cut(s) 128, 174
BstV1I GCAGC 2 cut(s) 156, 173
BsuRI GGCC 1 cut(s) 179
BtsCI GGATG 2 cut(s) 5, 171
BtsIMutI CAGTG 1 cut(s) 37
CfoI GCGC 1 cut(s) 186
Cfr13I GGNCC 2 cut(s) 153, 178
CviJI RGCY 2 cut(s) 147, 179
CviKI_1 RGCY 2 cut(s) 147, 179
DpnI GATC 1 cut(s) 134
DpnII GATC 1 cut(s) 132
DrdI GACNNNNNNGTC 1 cut(s) 122
DseDI GACNNNNNNGTC 1 cut(s) 122
Eco47I GGWCC 1 cut(s) 153
Eco47III AGCGCT 1 cut(s) 185
EcoO109I RGGNCCY 1 cut(s) 153
EcoRI GAATTC 1 cut(s) 101
EcoRII CCWGG 1 cut(s) 174
Fnu4HI GCNGC 2 cut(s) 145, 187
FokI GGATG 1 cut(s) 158
Fsp4HI GCNGC 2 cut(s) 145, 187
FspBI CTAG 1 cut(s) 190
GlaI GCGC 1 cut(s) 185
GluI GCNGC 2 cut(s) 145, 187
GsaI CCCAGC 1 cut(s) 184
HaeII RGCGCY 1 cut(s) 187
HaeIII GGCC 1 cut(s) 179
HapII CCGG 1 cut(s) 130
HhaI GCGC 1 cut(s) 186
Hin6I GCGC 1 cut(s) 184
HinP1I GCGC 1 cut(s) 184
HinfI GANTC 2 cut(s) 35, 164
HpaII CCGG 1 cut(s) 130
Hpy188I TCNGA 1 cut(s) 88
Hpy99I CGWCG 1 cut(s) 128
HpyAV CCTTC 1 cut(s) 93
HpyCH4III ACNGT 1 cut(s) 32
HpyCH4IV ACGT 1 cut(s) 123
HpySE526I ACGT 1 cut(s) 123
HspAI GCGC 1 cut(s) 184
Kzo9I GATC 1 cut(s) 132
LpnPI CCDG 5 cut(s) 143, 161, 169, 174, 188
Lsp1109I GCAGC 2 cut(s) 156, 173
LweI GCATC 1 cut(s) 14
MaeI CTAG 1 cut(s) 190
MaeII ACGT 1 cut(s) 123
MalI GATC 1 cut(s) 134
MboI GATC 1 cut(s) 132
MboII GAAGA 1 cut(s) 64
MluCI AATT 1 cut(s) 101
MlyI GAGTC 1 cut(s) 158
MnlI CCTC 3 cut(s) 19, 35, 61
MspI CCGG 1 cut(s) 130
MspR9I CCNGG 2 cut(s) 130, 176
MvaI CCWGG 1 cut(s) 176
NciI CCSGG 1 cut(s) 130
NdeII GATC 1 cut(s) 132
NlaIV GGNNCC 1 cut(s) 154
PcsI WCGNNNNNNNCGW 1 cut(s) 120
PfeI GAWTC 1 cut(s) 35
PkrI GCNGC 2 cut(s) 146, 188
PleI GAGTC 1 cut(s) 158
PpsI GAGTC 1 cut(s) 158
PpuMI RGGWCCY 1 cut(s) 153
Psp5II RGGWCCY 1 cut(s) 153
Psp6I CCWGG 1 cut(s) 174
PspFI CCCAGC 1 cut(s) 180
PspGI CCWGG 1 cut(s) 174
PspN4I GGNNCC 1 cut(s) 154
PspPI GGNCC 2 cut(s) 153, 178
PspPPI RGGWCCY 1 cut(s) 153
SatI GCNGC 2 cut(s) 145, 187
Sau3AI GATC 1 cut(s) 132
Sau96I GGNCC 2 cut(s) 153, 178
SchI GAGTC 1 cut(s) 158
ScrFI CCNGG 2 cut(s) 130, 176
SetI ASST 2 cut(s) 126, 149
SfaNI GCATC 1 cut(s) 14
SgeI CNNG 9 cut(s) 59, 125, 141, 142, 163, 168, 173, 187, 188
SinI GGWCC 1 cut(s) 153
Sse9I AATT 1 cut(s) 101
SspMI CTAG 1 cut(s) 190
StyD4I CCNGG 2 cut(s) 128, 174
TaaI ACNGT 1 cut(s) 32
TaiI ACGT 1 cut(s) 126
TasI AATT 1 cut(s) 101
TfiI GAWTC 1 cut(s) 35
TscAI CASTG 1 cut(s) 37
TseI GCWGC 2 cut(s) 144, 186
TspDTI ATGAA 1 cut(s) 64
TspRI CASTG 1 cut(s) 37
VpaK11BI GGWCC 1 cut(s) 153
XapI RAATTY 1 cut(s) 101
XspI CTAG 1 cut(s) 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.