Rh6CG212500

Aminotransferase class-V

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0005210
Physical Location & Seq
Forward (+)
35317373 .. 35330371
12999 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG212500.1

Sequence Viewer

Length: 447 bp
ATGGCGATTCCAACACCCACGCCTCCAAAAAGCCCAAACTCTCCTTCATCACCCCCTCCGAAATCGCCGCCGAATTCTCCCACCACGACCCCACCGTCGCCTGAATCAACAACGACAGCTTCGGGTCCTGCCCCGACTACGTCCTCCAGGCCCAGCGCCGCTGGCAGCTCAACCGGCATCCTCCACTCCCGCACCCTCATCAAGGACCTCATCAACGCCGACCACGTCCACGAGGTCTCCATCGTCGACAACGCCACCACTGCCGCCGCCATCGTCCTCCAGCAAGCCGCCTGGGGCTTCTCCGAGAGCAAATGTGTTAGTCGAGATGAGGCCGCCTTGGCTGTGGCTCAAAAGTTCCGGGCAGCTACTCAGTTGCAATTTGATTTCCATCGAGCAATTTACAACCTTGGAACTGTATTGTTGGGTGATTTTGATGAAAAGGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00270 map00270
Pfam Domains
Protein Families
Aminotran_5

Protein Analysis

148

Amino Acids

15.39

Weight (kDa)

6.39

Isoelectric Point (pI)

55.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 94
AccI GTMKAC 1 cut(s) 246
AciI CCGC 7 cut(s) 68, 159, 190, 264, 267, 288, 333
AcsI RAATTY 1 cut(s) 73
AfiI CCNNNNNNNGG 1 cut(s) 202
AjiI CACGTC 1 cut(s) 226
AjnI CCWGG 2 cut(s) 146, 290
AjuI GAANNNNNNNTTGG 2 cut(s) 28, 60
AluBI AGCT 3 cut(s) 119, 168, 365
AluI AGCT 3 cut(s) 119, 168, 365
Alw26I GTCTC 1 cut(s) 241
AoxI GGCC 2 cut(s) 149, 330
ApeKI GCWGC 2 cut(s) 165, 362
ApoI RAATTY 1 cut(s) 73
AspLEI GCGC 1 cut(s) 158
AspS9I GGNCC 3 cut(s) 125, 150, 205
AsuC2I CCSGG 1 cut(s) 359
AsuHPI GGTGA 2 cut(s) 42, 437
AvaII GGWCC 2 cut(s) 125, 205
BauI CACGAG 1 cut(s) 230
BbvI GCAGC 2 cut(s) 177, 374
BccI CCATC 3 cut(s) 248, 278, 396
BciT130I CCWGG 2 cut(s) 148, 292
BcnI CCSGG 1 cut(s) 359
BcoDI GTCTC 1 cut(s) 241
BfoI RGCGCY 1 cut(s) 159
BglI GCCNNNNNGGC 1 cut(s) 338
BisI GCNGC 8 cut(s) 68, 159, 166, 264, 267, 288, 333, 363
BlsI GCNGC 8 cut(s) 69, 160, 167, 265, 268, 289, 334, 364
Bme1390I CCNGG 3 cut(s) 148, 292, 359
Bme18I GGWCC 2 cut(s) 125, 205
BmgBI CACGTC 1 cut(s) 226
BmgT120I GGNCC 3 cut(s) 125, 150, 205
BmiI GGNNCC 1 cut(s) 126
BmrFI CCNGG 3 cut(s) 148, 292, 359
BmsI GCATC 1 cut(s) 186
BpmI CTGGAG 2 cut(s) 130, 263
BpuMI CCSGG 1 cut(s) 359
BsaBI GATNNNNATC 1 cut(s) 387
BsaI GGTCTC 1 cut(s) 241
BsaJI CCNNGG 3 cut(s) 291, 336, 406
BsaXI ACNNNNNCTCC 2 cut(s) 221, 251
Bsc4I CCNNNNNNNGG 1 cut(s) 202
Bse118I RCCGGY 1 cut(s) 173
Bse8I GATNNNNATC 1 cut(s) 387
BseBI CCWGG 2 cut(s) 148, 292
BseDI CCNNGG 3 cut(s) 291, 336, 406
BseGI GGATG 1 cut(s) 177
BseJI GATNNNNATC 1 cut(s) 387
BseLI CCNNNNNNNGG 1 cut(s) 202
BseMII CTCAG 1 cut(s) 383
BseXI GCAGC 2 cut(s) 177, 374
BseYI CCCAGC 1 cut(s) 152
BshFI GGCC 2 cut(s) 151, 332
BsiSI CCGG 2 cut(s) 174, 358
BslI CCNNNNNNNGG 1 cut(s) 202
BsmAI GTCTC 1 cut(s) 241
BsnI GGCC 2 cut(s) 151, 332
Bso31I GGTCTC 1 cut(s) 241
BspACI CCGC 7 cut(s) 68, 159, 190, 264, 267, 288, 333
BspANI GGCC 2 cut(s) 151, 332
BspCNI CTCAG 1 cut(s) 382
BspLI GGNNCC 1 cut(s) 126
BspTNI GGTCTC 1 cut(s) 241
BsrFI RCCGGY 1 cut(s) 173
BssAI RCCGGY 1 cut(s) 173
BssECI CCNNGG 3 cut(s) 291, 336, 406
BssSI CACGAG 1 cut(s) 230
BssT1I CCWWGG 2 cut(s) 336, 406
Bst2BI CACGAG 1 cut(s) 230
Bst2UI CCWGG 2 cut(s) 148, 292
Bst4CI ACNGT 2 cut(s) 96, 415
BstC8I GCNNGC 2 cut(s) 163, 285
BstDEI CTNAG 1 cut(s) 369
BstENI CCTNNNNNAGG 1 cut(s) 200
BstF5I GGATG 1 cut(s) 177
BstH2I RGCGCY 1 cut(s) 159
BstHHI GCGC 1 cut(s) 158
BstMAI GTCTC 1 cut(s) 241
BstMWI GCNNNNNNNGC 4 cut(s) 162, 174, 260, 338
BstNI CCWGG 2 cut(s) 148, 292
BstSCI CCNGG 3 cut(s) 146, 290, 357
BstV1I GCAGC 2 cut(s) 177, 374
BsuRI GGCC 2 cut(s) 151, 332
BtrI CACGTC 1 cut(s) 226
BtsCI GGATG 1 cut(s) 177
BtsI GCAGTG 1 cut(s) 258
BtsIMutI CAGTG 1 cut(s) 258
Cac8I GCNNGC 2 cut(s) 163, 285
CfoI GCGC 1 cut(s) 158
Cfr10I RCCGGY 1 cut(s) 173
Cfr13I GGNCC 3 cut(s) 125, 150, 205
DdeI CTNAG 1 cut(s) 369
DrdI GACNNNNNNGTC 1 cut(s) 94
DseDI GACNNNNNNGTC 1 cut(s) 94
Eco130I CCWWGG 2 cut(s) 336, 406
Eco31I GGTCTC 1 cut(s) 241
Eco47I GGWCC 2 cut(s) 125, 205
EcoNI CCTNNNNNAGG 1 cut(s) 200
EcoO109I RGGNCCY 2 cut(s) 125, 205
EcoRI GAATTC 1 cut(s) 73
EcoRII CCWGG 2 cut(s) 146, 290
EcoT14I CCWWGG 2 cut(s) 336, 406
ErhI CCWWGG 2 cut(s) 336, 406
FauI CCCGC 1 cut(s) 197
FblI GTMKAC 1 cut(s) 246
Fnu4HI GCNGC 8 cut(s) 68, 159, 166, 264, 267, 288, 333, 363
FokI GGATG 1 cut(s) 164
Fsp4HI GCNGC 8 cut(s) 68, 159, 166, 264, 267, 288, 333, 363
GlaI GCGC 1 cut(s) 157
GluI GCNGC 8 cut(s) 68, 159, 166, 264, 267, 288, 333, 363
GsaI CCCAGC 1 cut(s) 156
GsuI CTGGAG 2 cut(s) 130, 263
HaeII RGCGCY 1 cut(s) 159
HaeIII GGCC 2 cut(s) 151, 332
HapII CCGG 2 cut(s) 174, 358
HhaI GCGC 1 cut(s) 158
Hin6I GCGC 1 cut(s) 156
HinP1I GCGC 1 cut(s) 156
HincII GTYRAC 1 cut(s) 247
HindII GTYRAC 1 cut(s) 247
HinfI GANTC 2 cut(s) 7, 104
HpaII CCGG 2 cut(s) 174, 358
HphI GGTGA 2 cut(s) 42, 437
Hpy166II GTNNAC 2 cut(s) 229, 247
Hpy188I TCNGA 2 cut(s) 60, 304
Hpy188III TCNNGA 1 cut(s) 323
Hpy8I GTNNAC 2 cut(s) 229, 247
Hpy99I CGWCG 2 cut(s) 100, 248
HpyAV CCTTC 1 cut(s) 54
HpyCH4III ACNGT 2 cut(s) 96, 415
HpyCH4IV ACGT 2 cut(s) 140, 225
HpyCH4V TGCA 1 cut(s) 376
HpyF10VI GCNNNNNNNGC 4 cut(s) 162, 174, 260, 338
HpyF3I CTNAG 1 cut(s) 369
HpySE526I ACGT 2 cut(s) 140, 225
HspAI GCGC 1 cut(s) 156
Lsp1109I GCAGC 2 cut(s) 177, 374
LweI GCATC 1 cut(s) 186
MaeII ACGT 2 cut(s) 140, 225
MluCI AATT 3 cut(s) 73, 377, 396
MmeI TCCRAC 1 cut(s) 35
MnlI CCTC 9 cut(s) 33, 66, 154, 191, 206, 218, 226, 287, 322
MseI TTAA 1 cut(s) 445
MspA1I CMGCKG 1 cut(s) 161
MspI CCGG 2 cut(s) 174, 358
MspR9I CCNGG 3 cut(s) 148, 292, 359
MvaI CCWGG 2 cut(s) 148, 292
MwoI GCNNNNNNNGC 4 cut(s) 162, 174, 260, 338
NciI CCSGG 1 cut(s) 359
NlaIV GGNNCC 1 cut(s) 126
PcsI WCGNNNNNNNCGW 2 cut(s) 92, 222
PfeI GAWTC 2 cut(s) 7, 104
PflFI GACNNNGTC 2 cut(s) 139, 224
PkrI GCNGC 8 cut(s) 69, 160, 167, 265, 268, 289, 334, 364
PpuMI RGGWCCY 2 cut(s) 125, 205
Psp5II RGGWCCY 2 cut(s) 125, 205
Psp6I CCWGG 2 cut(s) 146, 290
PspFI CCCAGC 1 cut(s) 152
PspGI CCWGG 2 cut(s) 146, 290
PspN4I GGNNCC 1 cut(s) 126
PspPI GGNCC 3 cut(s) 125, 150, 205
PspPPI RGGWCCY 2 cut(s) 125, 205
PsyI GACNNNGTC 2 cut(s) 139, 224
SalI GTCGAC 1 cut(s) 245
SaqAI TTAA 1 cut(s) 445
SatI GCNGC 8 cut(s) 68, 159, 166, 264, 267, 288, 333, 363
Sau96I GGNCC 3 cut(s) 125, 150, 205
ScrFI CCNGG 3 cut(s) 148, 292, 359
SetI ASST 8 cut(s) 121, 143, 170, 210, 228, 237, 367, 408
SfaNI GCATC 1 cut(s) 186
SinI GGWCC 2 cut(s) 125, 205
Sse9I AATT 3 cut(s) 73, 377, 396
SsiI CCGC 7 cut(s) 68, 159, 190, 264, 267, 288, 333
StyD4I CCNGG 3 cut(s) 146, 290, 357
StyI CCWWGG 2 cut(s) 336, 406
TaaI ACNGT 2 cut(s) 96, 415
TaiI ACGT 2 cut(s) 143, 228
TaqI TCGA 3 cut(s) 246, 322, 391
TasI AATT 3 cut(s) 73, 377, 396
TauI GCSGC 6 cut(s) 70, 161, 266, 269, 290, 335
TfiI GAWTC 2 cut(s) 7, 104
Tru1I TTAA 1 cut(s) 445
Tru9I TTAA 1 cut(s) 445
TscAI CASTG 1 cut(s) 265
TseI GCWGC 2 cut(s) 165, 362
TspDTI ATGAA 1 cut(s) 36
TspRI CASTG 1 cut(s) 265
Tth111I GACNNNGTC 2 cut(s) 139, 224
VpaK11BI GGWCC 2 cut(s) 125, 205
XagI CCTNNNNNAGG 1 cut(s) 200
XapI RAATTY 1 cut(s) 73
XmiI GTMKAC 1 cut(s) 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.