Rh7DG393400

Aminotransferase class-V

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0005210
Physical Location & Seq
Forward (+)
53928912 .. 53932216
3305 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG393400.1

Sequence Viewer

Length: 336 bp
ATGGCCTCCTCCCCCGACCACAACCACACCCTGAACGGCGATTCCAACACCCACGCCTCCAAAAAGCCCAAACTCTCCTTCATCACCCCCTCCGAAATCGCCGCCGAATTCTCCCACCACGACCCCACCGTCGCCCGAATCAACAACGGCAGCTTCGGGTCCTGCCCCTACTCCGTCCTCCAGGCCCAGCGCTGCTGGCAGCTCAAATGTGTTAGTCGAGATGAGGCTGCCTTGGCTGTGGCTCAAAAGGCAAAGCCATGGCCTTTTACTGAGTGGAAGTTTTATAGCATTTTCTTTATTCGTGGCGCATCAATTTATGCAGAACAGGTCAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00270 map00270
Pfam Domains
Protein Families
Aminotran_5

Protein Analysis

111

Amino Acids

12.4

Weight (kDa)

8.86

Isoelectric Point (pI)

35.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 128
AciI CCGC 1 cut(s) 102
AcsI RAATTY 1 cut(s) 107
AfeI AGCGCT 1 cut(s) 191
AjnI CCWGG 1 cut(s) 180
AjuI GAANNNNNNNTTGG 2 cut(s) 62, 94
AloI GAACNNNNNNTCC 2 cut(s) 26, 58
AluBI AGCT 2 cut(s) 153, 202
AluI AGCT 2 cut(s) 153, 202
Aor51HI AGCGCT 1 cut(s) 191
AoxI GGCC 3 cut(s) 3, 183, 260
ApeKI GCWGC 4 cut(s) 150, 192, 199, 227
ApoI RAATTY 1 cut(s) 107
AspLEI GCGC 2 cut(s) 192, 308
AspS9I GGNCC 2 cut(s) 159, 184
AsuHPI GGTGA 1 cut(s) 76
AvaII GGWCC 1 cut(s) 159
BbvI GCAGC 4 cut(s) 162, 179, 211, 214
BceAI ACGGC 2 cut(s) 52, 163
BciT130I CCWGG 1 cut(s) 182
BfoI RGCGCY 1 cut(s) 193
BisI GCNGC 5 cut(s) 102, 151, 193, 200, 228
BlsI GCNGC 5 cut(s) 103, 152, 194, 201, 229
Bme1390I CCNGG 1 cut(s) 182
Bme18I GGWCC 1 cut(s) 159
BmgT120I GGNCC 2 cut(s) 159, 184
BmiI GGNNCC 1 cut(s) 160
BmrFI CCNGG 1 cut(s) 182
BmsI GCATC 1 cut(s) 317
BpmI CTGGAG 1 cut(s) 164
BsaJI CCNNGG 2 cut(s) 231, 257
BseBI CCWGG 1 cut(s) 182
BseDI CCNNGG 2 cut(s) 231, 257
BseMII CTCAG 1 cut(s) 261
BseXI GCAGC 4 cut(s) 162, 179, 211, 214
BseYI CCCAGC 1 cut(s) 186
BshFI GGCC 3 cut(s) 5, 185, 262
BsnI GGCC 3 cut(s) 5, 185, 262
Bsp19I CCATGG 1 cut(s) 257
BspACI CCGC 1 cut(s) 102
BspANI GGCC 3 cut(s) 5, 185, 262
BspCNI CTCAG 1 cut(s) 262
BspLI GGNNCC 1 cut(s) 160
BssECI CCNNGG 2 cut(s) 231, 257
BssT1I CCWWGG 2 cut(s) 231, 257
Bst2UI CCWGG 1 cut(s) 182
Bst4CI ACNGT 1 cut(s) 130
BstC8I GCNNGC 1 cut(s) 197
BstDEI CTNAG 1 cut(s) 270
BstDSI CCRYGG 1 cut(s) 257
BstH2I RGCGCY 1 cut(s) 193
BstHHI GCGC 2 cut(s) 192, 308
BstMWI GCNNNNNNNGC 3 cut(s) 196, 233, 248
BstNI CCWGG 1 cut(s) 182
BstSCI CCNGG 1 cut(s) 180
BstV1I GCAGC 4 cut(s) 162, 179, 211, 214
BsuRI GGCC 3 cut(s) 5, 185, 262
BtgI CCRYGG 1 cut(s) 257
Cac8I GCNNGC 1 cut(s) 197
CfoI GCGC 2 cut(s) 192, 308
Cfr13I GGNCC 2 cut(s) 159, 184
CviAII CATG 1 cut(s) 258
DdeI CTNAG 1 cut(s) 270
DrdI GACNNNNNNGTC 1 cut(s) 128
DseDI GACNNNNNNGTC 1 cut(s) 128
Eco130I CCWWGG 2 cut(s) 231, 257
Eco47I GGWCC 1 cut(s) 159
Eco47III AGCGCT 1 cut(s) 191
EcoO109I RGGNCCY 1 cut(s) 159
EcoRI GAATTC 1 cut(s) 107
EcoRII CCWGG 1 cut(s) 180
EcoT14I CCWWGG 2 cut(s) 231, 257
ErhI CCWWGG 2 cut(s) 231, 257
FaeI CATG 1 cut(s) 261
FaiI YATR 3 cut(s) 259, 285, 318
FatI CATG 1 cut(s) 257
Fnu4HI GCNGC 5 cut(s) 102, 151, 193, 200, 228
Fsp4HI GCNGC 5 cut(s) 102, 151, 193, 200, 228
GlaI GCGC 2 cut(s) 191, 307
GluI GCNGC 5 cut(s) 102, 151, 193, 200, 228
GsaI CCCAGC 1 cut(s) 190
GsuI CTGGAG 1 cut(s) 164
HaeII RGCGCY 1 cut(s) 193
HaeIII GGCC 3 cut(s) 5, 185, 262
HhaI GCGC 2 cut(s) 192, 308
Hin1II CATG 1 cut(s) 261
Hin6I GCGC 2 cut(s) 190, 306
HinP1I GCGC 2 cut(s) 190, 306
HinfI GANTC 2 cut(s) 41, 138
HphI GGTGA 1 cut(s) 76
Hpy188I TCNGA 1 cut(s) 94
Hpy188III TCNNGA 1 cut(s) 218
Hpy99I CGWCG 1 cut(s) 134
HpyAV CCTTC 1 cut(s) 88
HpyCH4III ACNGT 1 cut(s) 130
HpyCH4V TGCA 1 cut(s) 320
HpyF10VI GCNNNNNNNGC 3 cut(s) 196, 233, 248
HpyF3I CTNAG 1 cut(s) 270
Hsp92II CATG 1 cut(s) 261
HspAI GCGC 2 cut(s) 190, 306
LpnPI CCDG 7 cut(s) 44, 167, 175, 181, 194, 200, 311
Lsp1109I GCAGC 4 cut(s) 162, 179, 211, 214
LweI GCATC 1 cut(s) 317
MluCI AATT 2 cut(s) 107, 312
MmeI TCCRAC 1 cut(s) 69
MnlI CCTC 6 cut(s) 16, 19, 67, 100, 188, 217
MspR9I CCNGG 1 cut(s) 182
MvaI CCWGG 1 cut(s) 182
MwoI GCNNNNNNNGC 3 cut(s) 196, 233, 248
NcoI CCATGG 1 cut(s) 257
NlaIII CATG 1 cut(s) 261
NlaIV GGNNCC 1 cut(s) 160
PcsI WCGNNNNNNNCGW 1 cut(s) 126
PfeI GAWTC 2 cut(s) 41, 138
PkrI GCNGC 5 cut(s) 103, 152, 194, 201, 229
PpuMI RGGWCCY 1 cut(s) 159
Psp5II RGGWCCY 1 cut(s) 159
Psp6I CCWGG 1 cut(s) 180
PspFI CCCAGC 1 cut(s) 186
PspGI CCWGG 1 cut(s) 180
PspN4I GGNNCC 1 cut(s) 160
PspPI GGNCC 2 cut(s) 159, 184
PspPPI RGGWCCY 1 cut(s) 159
SatI GCNGC 5 cut(s) 102, 151, 193, 200, 228
Sau96I GGNCC 2 cut(s) 159, 184
ScrFI CCNGG 1 cut(s) 182
SetI ASST 3 cut(s) 155, 204, 330
SfaNI GCATC 1 cut(s) 317
SinI GGWCC 1 cut(s) 159
Sse9I AATT 2 cut(s) 107, 312
SsiI CCGC 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 180
StyI CCWWGG 2 cut(s) 231, 257
TaaI ACNGT 1 cut(s) 130
TaqI TCGA 1 cut(s) 217
TasI AATT 2 cut(s) 107, 312
TauI GCSGC 1 cut(s) 104
TfiI GAWTC 2 cut(s) 41, 138
TseI GCWGC 4 cut(s) 150, 192, 199, 227
TspDTI ATGAA 1 cut(s) 70
TspGWI ACGGA 1 cut(s) 163
VpaK11BI GGWCC 1 cut(s) 159
XapI RAATTY 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.