RchiOBHm_Chr5g0037941

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0003968
Physical Location & Seq
Forward (+)
32619323 .. 32620310
988 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31661

Sequence Viewer

Length: 252 bp
ATGTCAGAGATTTCAAATAAATGGAGATATTTCAGACTTGATGGAGAGCCACCAACACCTCATGAACCTAATTGGTTCACAATTGCATTTCACCATGGGGGGAGGTTTTATAGGTTGGGAAGTGGTAATAGGTTTTACAAGGGAGGAGAGGTGGCTTATGTGGACAAAATGGAGACTGATAAGATTTCATGGACTTGTCTGAATTGTTTTGCTGAAGACTTGGGGTACAGACATCCTCCAATCGCTTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DBD_Tnp_Mut MULE SWIM

Protein Analysis

83

Amino Acids

9.78

Weight (kDa)

6.89

Isoelectric Point (pI)

33.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PB1-like PF26130 24 - 77 4.1e-11 PB1-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 234
AfaI GTAC 1 cut(s) 227
AgsI TTSAA 1 cut(s) 15
Alw26I GTCTC 1 cut(s) 167
AsuHPI GGTGA 1 cut(s) 83
BbsI GAAGAC 1 cut(s) 222
BccI CCATC 1 cut(s) 35
BcoDI GTCTC 1 cut(s) 167
BpiI GAAGAC 1 cut(s) 222
BsaJI CCNNGG 1 cut(s) 94
BsaXI ACNNNNNCTCC 2 cut(s) 135, 165
BseDI CCNNGG 1 cut(s) 94
BseGI GGATG 1 cut(s) 232
BseRI GAGGAG 1 cut(s) 159
BsmAI GTCTC 1 cut(s) 167
Bsp19I CCATGG 1 cut(s) 94
BspHI TCATGA 1 cut(s) 61
BssECI CCNNGG 1 cut(s) 94
BssT1I CCWWGG 1 cut(s) 94
BstDSI CCRYGG 1 cut(s) 94
BstF5I GGATG 1 cut(s) 232
BstMAI GTCTC 1 cut(s) 167
BstV2I GAAGAC 1 cut(s) 222
BtgI CCRYGG 1 cut(s) 94
BtsCI GGATG 1 cut(s) 232
CciI TCATGA 1 cut(s) 61
Csp6I GTAC 1 cut(s) 226
CviAII CATG 3 cut(s) 62, 95, 189
CviJI RGCY 2 cut(s) 49, 155
CviKI_1 RGCY 2 cut(s) 49, 155
CviQI GTAC 1 cut(s) 226
Eco130I CCWWGG 1 cut(s) 94
Eco57I CTGAAG 1 cut(s) 234
EcoT14I CCWWGG 1 cut(s) 94
ErhI CCWWGG 1 cut(s) 94
FaeI CATG 3 cut(s) 65, 98, 192
FaiI YATR 5 cut(s) 63, 96, 111, 159, 190
FatI CATG 3 cut(s) 61, 94, 188
FokI GGATG 1 cut(s) 219
Hin1II CATG 3 cut(s) 65, 98, 192
HphI GGTGA 1 cut(s) 83
Hpy166II GTNNAC 2 cut(s) 78, 163
Hpy188I TCNGA 3 cut(s) 7, 35, 201
Hpy188III TCNNGA 1 cut(s) 62
Hpy8I GTNNAC 2 cut(s) 78, 163
HpyCH4V TGCA 1 cut(s) 86
Hsp92II CATG 3 cut(s) 65, 98, 192
MboII GAAGA 1 cut(s) 227
MfeI CAATTG 1 cut(s) 81
MluCI AATT 3 cut(s) 70, 81, 202
MnlI CCTC 5 cut(s) 69, 96, 137, 142, 246
MunI CAATTG 1 cut(s) 81
NcoI CCATGG 1 cut(s) 94
NlaIII CATG 3 cut(s) 65, 98, 192
PagI TCATGA 1 cut(s) 61
RsaI GTAC 1 cut(s) 227
RsaNI GTAC 1 cut(s) 226
SetI ASST 6 cut(s) 61, 70, 107, 116, 134, 153
SgeI CNNG 7 cut(s) 50, 74, 107, 151, 201, 207, 232
Sse9I AATT 3 cut(s) 70, 81, 202
StyI CCWWGG 1 cut(s) 94
TasI AATT 3 cut(s) 70, 81, 202
TspDTI ATGAA 2 cut(s) 78, 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.