Rh7BG445600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
51947591 .. 51947968
378 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG445600.1

Sequence Viewer

Length: 378 bp
ATGGCTAGACTAAGGGCTATCGATGTTGGTCCGAGTTCTTTTGGTCGTACAAGTGCATTTGAATATCCAATTTCTGAATTGAGTGAAGGTTCATTTGGTGGTCTAAGTAGTCAAACAATGGGGCATGGTGTTCTTCACCCTACTGATGGTGAGCTACATGGAGTAAAAGGTGTAGAACAAGACAAAACAGATGATGTAGGAGAATTAACCAAGTTTGTGGATCATGTTGAAGAAGAATTTGAAGATGAAGACTCACAAGATGAGGACTATGTACCTCCAGACCCTTCCGAACCACTAGAGGAAGTGCTAGTTGATAGTGATTATGAAATCTTGCCAGAAGATGATAATGAGTTAGTACATCATACATGTGGTGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

125

Amino Acids

13.69

Weight (kDa)

4.05

Isoelectric Point (pI)

51.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 228
AcsI RAATTY 1 cut(s) 236
AfaI GTAC 3 cut(s) 49, 273, 357
AfiI CCNNNNNNNGG 1 cut(s) 146
AflIII ACRYGT 1 cut(s) 365
AgsI TTSAA 3 cut(s) 62, 230, 242
AjuI GAANNNNNNNTTGG 2 cut(s) 78, 110
AluBI AGCT 1 cut(s) 154
AluI AGCT 1 cut(s) 154
AlwI GGATC 1 cut(s) 228
ApoI RAATTY 1 cut(s) 236
AspS9I GGNCC 1 cut(s) 29
AsuHPI GGTGA 2 cut(s) 128, 161
AvaII GGWCC 1 cut(s) 29
BbsI GAAGAC 1 cut(s) 255
BccI CCATC 1 cut(s) 140
BfaI CTAG 3 cut(s) 6, 296, 308
Bme18I GGWCC 1 cut(s) 29
BmgT120I GGNCC 1 cut(s) 29
BpiI GAAGAC 1 cut(s) 255
BpmI CTGGAG 1 cut(s) 261
Bsa29I ATCGAT 1 cut(s) 21
Bsc4I CCNNNNNNNGG 1 cut(s) 146
BseCI ATCGAT 1 cut(s) 21
BseLI CCNNNNNNNGG 1 cut(s) 146
BshVI ATCGAT 1 cut(s) 21
BslI CCNNNNNNNGG 1 cut(s) 146
Bsp143I GATC 1 cut(s) 220
BspDI ATCGAT 1 cut(s) 21
BspPI GGATC 1 cut(s) 228
BssMI GATC 1 cut(s) 220
BstDEI CTNAG 2 cut(s) 11, 104
BstKTI GATC 1 cut(s) 223
BstMBI GATC 1 cut(s) 220
BstNSI RCATGY 1 cut(s) 369
BstV2I GAAGAC 1 cut(s) 255
BstXI CCANNNNNNTGG 1 cut(s) 217
Bsu15I ATCGAT 1 cut(s) 21
BsuTUI ATCGAT 1 cut(s) 21
Cfr13I GGNCC 1 cut(s) 29
ClaI ATCGAT 1 cut(s) 21
Csp6I GTAC 3 cut(s) 48, 272, 356
CviAII CATG 4 cut(s) 125, 158, 224, 366
CviJI RGCY 3 cut(s) 5, 17, 154
CviKI_1 RGCY 3 cut(s) 5, 17, 154
CviQI GTAC 3 cut(s) 48, 272, 356
DdeI CTNAG 2 cut(s) 11, 104
DpnI GATC 1 cut(s) 222
DpnII GATC 1 cut(s) 220
Eco47I GGWCC 1 cut(s) 29
FaeI CATG 4 cut(s) 128, 161, 227, 369
FaiI YATR 7 cut(s) 126, 159, 225, 270, 324, 363, 367
FatI CATG 4 cut(s) 124, 157, 223, 365
FspBI CTAG 3 cut(s) 6, 296, 308
GsuI CTGGAG 1 cut(s) 261
Hin1II CATG 4 cut(s) 128, 161, 227, 369
HinfI GANTC 1 cut(s) 251
HphI GGTGA 2 cut(s) 128, 161
Hpy188I TCNGA 3 cut(s) 33, 76, 289
Hpy188III TCNNGA 1 cut(s) 278
HpyAV CCTTC 2 cut(s) 80, 294
HpyCH4V TGCA 1 cut(s) 56
HpyF3I CTNAG 2 cut(s) 11, 104
Hsp92II CATG 4 cut(s) 128, 161, 227, 369
Kzo9I GATC 1 cut(s) 220
LpnPI CCDG 2 cut(s) 291, 348
MaeI CTAG 3 cut(s) 6, 296, 308
MalI GATC 1 cut(s) 222
MboI GATC 1 cut(s) 220
MboII GAAGA 6 cut(s) 125, 242, 245, 254, 260, 350
MluCI AATT 4 cut(s) 69, 77, 203, 236
MlyI GAGTC 1 cut(s) 245
MnlI CCTC 3 cut(s) 256, 285, 292
MseI TTAA 1 cut(s) 206
MslI CAYNNNNRTG 1 cut(s) 366
NdeII GATC 1 cut(s) 220
NlaIII CATG 4 cut(s) 128, 161, 227, 369
NspI RCATGY 1 cut(s) 369
PciI ACATGT 1 cut(s) 365
PleI GAGTC 1 cut(s) 245
PpsI GAGTC 1 cut(s) 245
PscI ACATGT 1 cut(s) 365
PspPI GGNCC 1 cut(s) 29
RsaI GTAC 3 cut(s) 49, 273, 357
RsaNI GTAC 3 cut(s) 48, 272, 356
RseI CAYNNNNRTG 1 cut(s) 366
SaqAI TTAA 1 cut(s) 206
Sau3AI GATC 1 cut(s) 220
Sau96I GGNCC 1 cut(s) 29
SchI GAGTC 1 cut(s) 245
SetI ASST 4 cut(s) 91, 156, 172, 277
SinI GGWCC 1 cut(s) 29
SmiMI CAYNNNNRTG 1 cut(s) 366
Sse9I AATT 4 cut(s) 69, 77, 203, 236
SspMI CTAG 3 cut(s) 6, 296, 308
TaqI TCGA 1 cut(s) 21
TasI AATT 4 cut(s) 69, 77, 203, 236
TatI WGTACW 1 cut(s) 355
Tru1I TTAA 1 cut(s) 206
Tru9I TTAA 1 cut(s) 206
TspDTI ATGAA 3 cut(s) 81, 261, 339
VpaK11BI GGWCC 1 cut(s) 29
XapI RAATTY 1 cut(s) 236
XceI RCATGY 1 cut(s) 369
XspI CTAG 3 cut(s) 6, 296, 308
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.