RchiOBHm_Chr6g0264021

This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
19127833 .. 19128319
487 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23680

Sequence Viewer

Length: 177 bp
ATGGGTTTGCTTGCTGCAGCACACTTGGCTGTTTATCAAATTATTGTGCTCCTTGTCCTCGACTTTTTGGGTAATAGCATTCCTGGTCTGAAAGTGGACAACGTACATGCCGTTTCGTTGAAAAATACACTGATATTCAATGCTTTTGTCTTCTGCCAATTAAGTGTTGAAATTTAA

Protein Analysis

58

Amino Acids

6.27

Weight (kDa)

5.96

Isoelectric Point (pI)

-4.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 171
AfaI GTAC 1 cut(s) 105
AgsI TTSAA 3 cut(s) 121, 139, 170
AjnI CCWGG 1 cut(s) 82
Alw21I GWGCWC 1 cut(s) 51
ApeKI GCWGC 2 cut(s) 14, 17
ApoI RAATTY 1 cut(s) 171
BbsI GAAGAC 1 cut(s) 142
Bbv12I GWGCWC 1 cut(s) 51
BbvI GCAGC 1 cut(s) 29
BceAI ACGGC 1 cut(s) 95
BciT130I CCWGG 1 cut(s) 84
BfmI CTRYAG 1 cut(s) 15
BisI GCNGC 2 cut(s) 15, 18
BlsI GCNGC 2 cut(s) 16, 19
Bme1390I CCNGG 1 cut(s) 84
BmrFI CCNGG 1 cut(s) 84
BpiI GAAGAC 1 cut(s) 142
BseBI CCWGG 1 cut(s) 84
BseXI GCAGC 1 cut(s) 29
BsiHKAI GWGCWC 1 cut(s) 51
BsmI GAATGC 1 cut(s) 78
Bsp1286I GDGCHC 1 cut(s) 51
BspMAI CTGCAG 1 cut(s) 19
Bst2UI CCWGG 1 cut(s) 84
BstC8I GCNNGC 1 cut(s) 12
BstMWI GCNNNNNNNGC 1 cut(s) 26
BstNI CCWGG 1 cut(s) 84
BstNSI RCATGY 1 cut(s) 110
BstSCI CCNGG 1 cut(s) 82
BstSFI CTRYAG 1 cut(s) 15
BstV1I GCAGC 1 cut(s) 29
BstV2I GAAGAC 1 cut(s) 142
BtsIMutI CAGTG 1 cut(s) 128
Cac8I GCNNGC 1 cut(s) 12
Csp6I GTAC 1 cut(s) 104
CviAII CATG 1 cut(s) 107
CviJI RGCY 1 cut(s) 29
CviKI_1 RGCY 1 cut(s) 29
CviQI GTAC 1 cut(s) 104
EcoRII CCWGG 1 cut(s) 82
FaeI CATG 1 cut(s) 110
FaiI YATR 1 cut(s) 108
FatI CATG 1 cut(s) 106
Fnu4HI GCNGC 2 cut(s) 15, 18
Fsp4HI GCNGC 2 cut(s) 15, 18
GluI GCNGC 2 cut(s) 15, 18
Hin1II CATG 1 cut(s) 110
Hpy166II GTNNAC 1 cut(s) 97
Hpy188I TCNGA 1 cut(s) 90
Hpy8I GTNNAC 1 cut(s) 97
HpyCH4IV ACGT 1 cut(s) 102
HpyCH4V TGCA 1 cut(s) 17
HpyF10VI GCNNNNNNNGC 1 cut(s) 26
HpySE526I ACGT 1 cut(s) 102
Hsp92II CATG 1 cut(s) 110
LmnI GCTCC 1 cut(s) 54
LpnPI CCDG 2 cut(s) 69, 96
Lsp1109I GCAGC 1 cut(s) 29
MaeII ACGT 1 cut(s) 102
MboII GAAGA 1 cut(s) 142
MhlI GDGCHC 1 cut(s) 51
MluCI AATT 3 cut(s) 39, 158, 171
MnlI CCTC 1 cut(s) 68
MseI TTAA 2 cut(s) 161, 175
MspR9I CCNGG 1 cut(s) 84
Mva1269I GAATGC 1 cut(s) 78
MvaI CCWGG 1 cut(s) 84
MwoI GCNNNNNNNGC 1 cut(s) 26
NlaIII CATG 1 cut(s) 110
NspI RCATGY 1 cut(s) 110
PcsI WCGNNNNNNNCGW 1 cut(s) 108
PctI GAATGC 1 cut(s) 78
PkrI GCNGC 2 cut(s) 16, 19
Psp6I CCWGG 1 cut(s) 82
PspGI CCWGG 1 cut(s) 82
PstI CTGCAG 1 cut(s) 19
RsaI GTAC 1 cut(s) 105
RsaNI GTAC 1 cut(s) 104
SaqAI TTAA 2 cut(s) 161, 175
SatI GCNGC 2 cut(s) 15, 18
ScrFI CCNGG 1 cut(s) 84
SduI GDGCHC 1 cut(s) 51
SetI ASST 1 cut(s) 105
SfcI CTRYAG 1 cut(s) 15
SgeI CNNG 7 cut(s) 23, 37, 65, 71, 95, 96, 119
Sse9I AATT 3 cut(s) 39, 158, 171
StyD4I CCNGG 1 cut(s) 82
TaiI ACGT 1 cut(s) 105
TaqI TCGA 1 cut(s) 60
TasI AATT 3 cut(s) 39, 158, 171
Tru1I TTAA 2 cut(s) 161, 175
Tru9I TTAA 2 cut(s) 161, 175
TscAI CASTG 1 cut(s) 135
TseI GCWGC 2 cut(s) 14, 17
TspRI CASTG 1 cut(s) 135
XapI RAATTY 1 cut(s) 171
XceI RCATGY 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.