RchiOBHm_Chr7g0201951

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
19622988 .. 19623218
231 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ18077

Sequence Viewer

Length: 216 bp
ATGGAATTGTTGGCTGTGGCATATTCGTCCCTTGTAGCCAAAATGGAGGAGATTATATATAGGTTGGTCATATGCTGGAATTTTCAGCCACACAGAAGTATTTTCTTGCATCTAATTCAACTTACAATGTGGAAGAGGCTGGTGATCTGTAAGGCAGAAATGGAGGAATGTATAGATTTGATAATGGAAGAATTAGAGAGAGTTTGTAAGAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.5

Weight (kDa)

5.6

Isoelectric Point (pI)

53.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 79
AgsI TTSAA 1 cut(s) 119
ApoI RAATTY 1 cut(s) 79
AsuHPI GGTGA 1 cut(s) 154
BmsI GCATC 1 cut(s) 118
BseRI GAGGAG 1 cut(s) 62
BslFI GGGAC 1 cut(s) 13
BsmFI GGGAC 1 cut(s) 13
Bsp143I GATC 1 cut(s) 144
BssMI GATC 1 cut(s) 144
Bst6I CTCTTC 1 cut(s) 128
BstKTI GATC 1 cut(s) 147
BstMBI GATC 1 cut(s) 144
CviJI RGCY 4 cut(s) 14, 38, 88, 139
CviKI_1 RGCY 4 cut(s) 14, 38, 88, 139
DpnI GATC 1 cut(s) 146
DpnII GATC 1 cut(s) 144
Eam1104I CTCTTC 1 cut(s) 128
EarI CTCTTC 1 cut(s) 128
FaiI YATR 7 cut(s) 22, 56, 58, 60, 71, 73, 173
FaqI GGGAC 1 cut(s) 13
FauNDI CATATG 1 cut(s) 71
HphI GGTGA 1 cut(s) 154
HpyCH4V TGCA 1 cut(s) 109
Kzo9I GATC 1 cut(s) 144
LpnPI CCDG 2 cut(s) 61, 125
LweI GCATC 1 cut(s) 118
MalI GATC 1 cut(s) 146
MboI GATC 1 cut(s) 144
MboII GAAGA 2 cut(s) 145, 200
MluCI AATT 4 cut(s) 5, 79, 114, 191
MnlI CCTC 3 cut(s) 40, 129, 157
NdeI CATATG 1 cut(s) 71
NdeII GATC 1 cut(s) 144
Sau3AI GATC 1 cut(s) 144
SetI ASST 1 cut(s) 65
SfaNI GCATC 1 cut(s) 118
SgeI CNNG 4 cut(s) 44, 88, 118, 152
Sse9I AATT 4 cut(s) 5, 79, 114, 191
TasI AATT 4 cut(s) 5, 79, 114, 191
XapI RAATTY 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.