RchiOBHm_Chr7g0216581

Ribosome biogenesis protein NSA2 homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
34201049 .. 34201953
905 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19379

Sequence Viewer

Length: 198 bp
ATGTTCTTCTCGACTCAAAAATTGGTTATGCACGAGGAGTCGTCGACTAGGCACAAGGTTGATGATGATGTTCATGAAGGGGCTGTTCCAACATATCCGTTGCATCGTGACAATACAACACGAGCAAAGGTGAGGCCTGTGGCTGAAGATGAGATGTTTAGAGTGCTTAGAACGGGCAAACGCAAGACCAAGCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.64

Weight (kDa)

9.59

Isoelectric Point (pI)

48.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 44
AcuI CTGAAG 1 cut(s) 165
AoxI GGCC 1 cut(s) 134
AsuHPI GGTGA 1 cut(s) 142
BauI CACGAG 2 cut(s) 32, 120
BfaI CTAG 1 cut(s) 48
BmsI GCATC 1 cut(s) 112
BseRI GAGGAG 1 cut(s) 50
BshFI GGCC 1 cut(s) 136
BsnI GGCC 1 cut(s) 136
BspANI GGCC 1 cut(s) 136
BspHI TCATGA 1 cut(s) 73
BssSI CACGAG 2 cut(s) 32, 120
Bst2BI CACGAG 2 cut(s) 32, 120
BstDEI CTNAG 1 cut(s) 167
BsuRI GGCC 1 cut(s) 136
CciI TCATGA 1 cut(s) 73
CviAII CATG 1 cut(s) 74
CviJI RGCY 3 cut(s) 83, 136, 143
CviKI_1 RGCY 3 cut(s) 83, 136, 143
DdeI CTNAG 1 cut(s) 167
Eco147I AGGCCT 1 cut(s) 136
Eco57I CTGAAG 1 cut(s) 165
FaeI CATG 1 cut(s) 77
FaiI YATR 3 cut(s) 29, 75, 94
FatI CATG 1 cut(s) 73
FblI GTMKAC 1 cut(s) 44
FspBI CTAG 1 cut(s) 48
HaeIII GGCC 1 cut(s) 136
Hin1II CATG 1 cut(s) 77
HincII GTYRAC 1 cut(s) 45
HindII GTYRAC 1 cut(s) 45
HinfI GANTC 2 cut(s) 13, 38
HphI GGTGA 1 cut(s) 142
Hpy166II GTNNAC 1 cut(s) 45
Hpy188III TCNNGA 3 cut(s) 10, 74, 107
Hpy8I GTNNAC 1 cut(s) 45
Hpy99I CGWCG 1 cut(s) 46
HpyAV CCTTC 1 cut(s) 71
HpyCH4V TGCA 2 cut(s) 31, 103
HpyF3I CTNAG 1 cut(s) 167
Hsp92II CATG 1 cut(s) 77
LpnPI CCDG 1 cut(s) 150
LweI GCATC 1 cut(s) 112
MaeI CTAG 1 cut(s) 48
MaeIII GTNAC 1 cut(s) 107
MboII GAAGA 1 cut(s) 158
MluCI AATT 1 cut(s) 20
MlyI GAGTC 2 cut(s) 7, 47
MmeI TCCRAC 1 cut(s) 113
MnlI CCTC 2 cut(s) 28, 126
NlaIII CATG 1 cut(s) 77
NmuCI GTSAC 1 cut(s) 107
PagI TCATGA 1 cut(s) 73
PceI AGGCCT 1 cut(s) 136
PleI GAGTC 2 cut(s) 7, 46
PpsI GAGTC 2 cut(s) 7, 46
SalI GTCGAC 1 cut(s) 43
SchI GAGTC 2 cut(s) 7, 47
SetI ASST 2 cut(s) 60, 132
SfaNI GCATC 1 cut(s) 112
Sse9I AATT 1 cut(s) 20
SseBI AGGCCT 1 cut(s) 136
SspMI CTAG 1 cut(s) 48
StuI AGGCCT 1 cut(s) 136
TaqI TCGA 2 cut(s) 11, 44
TasI AATT 1 cut(s) 20
TseFI GTSAC 1 cut(s) 107
Tsp45I GTSAC 1 cut(s) 107
TspDTI ATGAA 2 cut(s) 62, 90
TspGWI ACGGA 1 cut(s) 87
XmiI GTMKAC 1 cut(s) 44
XspI CTAG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.