Rh7CG318800

Ribosome biogenesis protein NSA2 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0002786
Physical Location & Seq
Forward (+)
34322586 .. 34323310
725 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG318800.1

Sequence Viewer

Length: 234 bp
ATGCATGAGGAGTCATCGACTAGGCACAAGGTTGATGATGATGATGTCCATGAAGGAGCTGTTCCAACATTGATGTTGGACCGTGACAATACAACACGAGCAAAGGTGAGGCCTGTGGCTGAAGATGAGATGTTTAAAGTGCTTAGAACGGGCAAACGCAAGACTAAGCAATGGAAGCGGATGATCACAAAAGCCACATTTGTGGGACCTGGTTTTACAAGGAAACCTCCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ribosomal_S8e

Protein Analysis

77

Amino Acids

8.91

Weight (kDa)

9.89

Isoelectric Point (pI)

45.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 178
AcuI CTGAAG 1 cut(s) 141
AjnI CCWGG 1 cut(s) 208
AleI CACNNNNGTG 1 cut(s) 200
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
AoxI GGCC 1 cut(s) 110
AspS9I GGNCC 2 cut(s) 79, 206
AsuHPI GGTGA 1 cut(s) 118
AvaII GGWCC 2 cut(s) 79, 206
BauI CACGAG 1 cut(s) 96
BciT130I CCWGG 1 cut(s) 210
BclI TGATCA 1 cut(s) 183
BfaI CTAG 2 cut(s) 21, 232
Bme1390I CCNGG 1 cut(s) 210
Bme18I GGWCC 2 cut(s) 79, 206
BmgT120I GGNCC 2 cut(s) 79, 206
BmiI GGNNCC 1 cut(s) 207
BmrFI CCNGG 1 cut(s) 210
Bse3DI GCAATG 1 cut(s) 176
BseBI CCWGG 1 cut(s) 210
BseGI GGATG 1 cut(s) 186
BseMI GCAATG 1 cut(s) 176
BseRI GAGGAG 1 cut(s) 23
BshFI GGCC 1 cut(s) 112
BslFI GGGAC 1 cut(s) 219
BsmFI GGGAC 1 cut(s) 219
BsnI GGCC 1 cut(s) 112
Bsp143I GATC 1 cut(s) 183
BspACI CCGC 1 cut(s) 178
BspANI GGCC 1 cut(s) 112
BspLI GGNNCC 1 cut(s) 207
BsrDI GCAATG 1 cut(s) 176
BssMI GATC 1 cut(s) 183
BssSI CACGAG 1 cut(s) 96
Bst2BI CACGAG 1 cut(s) 96
Bst2UI CCWGG 1 cut(s) 210
Bst4CI ACNGT 1 cut(s) 83
BstDEI CTNAG 2 cut(s) 143, 165
BstF5I GGATG 1 cut(s) 186
BstKTI GATC 1 cut(s) 186
BstMBI GATC 1 cut(s) 183
BstMWI GCNNNNNNNGC 1 cut(s) 175
BstNI CCWGG 1 cut(s) 210
BstSCI CCNGG 1 cut(s) 208
BstXI CCANNNNNNTGG 1 cut(s) 202
BsuRI GGCC 1 cut(s) 112
BtsCI GGATG 1 cut(s) 186
Cfr13I GGNCC 2 cut(s) 79, 206
CsiI ACCWGGT 1 cut(s) 208
CviAII CATG 2 cut(s) 5, 50
CviJI RGCY 4 cut(s) 59, 112, 119, 194
CviKI_1 RGCY 4 cut(s) 59, 112, 119, 194
DdeI CTNAG 2 cut(s) 143, 165
DpnI GATC 1 cut(s) 185
DpnII GATC 1 cut(s) 183
DraI TTTAAA 1 cut(s) 136
Eco147I AGGCCT 1 cut(s) 112
Eco47I GGWCC 2 cut(s) 79, 206
Eco57I CTGAAG 1 cut(s) 141
EcoO109I RGGNCCY 1 cut(s) 206
EcoRII CCWGG 1 cut(s) 208
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 2 cut(s) 8, 53
FaiI YATR 2 cut(s) 6, 51
FaqI GGGAC 1 cut(s) 219
FatI CATG 2 cut(s) 4, 49
FbaI TGATCA 1 cut(s) 183
FokI GGATG 1 cut(s) 193
FspBI CTAG 2 cut(s) 21, 232
HaeIII GGCC 1 cut(s) 112
Hin1II CATG 2 cut(s) 8, 53
HinfI GANTC 1 cut(s) 11
HphI GGTGA 1 cut(s) 118
HpyAV CCTTC 1 cut(s) 47
HpyCH4III ACNGT 1 cut(s) 83
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 175
HpyF3I CTNAG 2 cut(s) 143, 165
Hsp92II CATG 2 cut(s) 8, 53
Ksp22I TGATCA 1 cut(s) 183
Kzo9I GATC 1 cut(s) 183
LmnI GCTCC 1 cut(s) 56
LpnPI CCDG 3 cut(s) 126, 195, 222
MabI ACCWGGT 1 cut(s) 208
MaeI CTAG 2 cut(s) 21, 232
MaeIII GTNAC 1 cut(s) 83
MalI GATC 1 cut(s) 185
MboI GATC 1 cut(s) 183
MboII GAAGA 1 cut(s) 134
MlyI GAGTC 1 cut(s) 20
MmeI TCCRAC 2 cut(s) 57, 89
MnlI CCTC 1 cut(s) 102
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 135
MslI CAYNNNNRTG 1 cut(s) 200
MspR9I CCNGG 1 cut(s) 210
MvaI CCWGG 1 cut(s) 210
MwoI GCNNNNNNNGC 1 cut(s) 175
NdeII GATC 1 cut(s) 183
NlaIII CATG 2 cut(s) 8, 53
NlaIV GGNNCC 1 cut(s) 207
NmuCI GTSAC 1 cut(s) 83
NsiI ATGCAT 1 cut(s) 6
OliI CACNNNNGTG 1 cut(s) 200
PceI AGGCCT 1 cut(s) 112
PleI GAGTC 1 cut(s) 19
PpsI GAGTC 1 cut(s) 19
PpuMI RGGWCCY 1 cut(s) 206
Psp5II RGGWCCY 1 cut(s) 206
Psp6I CCWGG 1 cut(s) 208
PspGI CCWGG 1 cut(s) 208
PspN4I GGNNCC 1 cut(s) 207
PspPI GGNCC 2 cut(s) 79, 206
PspPPI RGGWCCY 1 cut(s) 206
RseI CAYNNNNRTG 1 cut(s) 200
SaqAI TTAA 1 cut(s) 135
Sau3AI GATC 1 cut(s) 183
Sau96I GGNCC 2 cut(s) 79, 206
SchI GAGTC 1 cut(s) 20
ScrFI CCNGG 1 cut(s) 210
SetI ASST 5 cut(s) 33, 61, 108, 211, 229
SexAI ACCWGGT 1 cut(s) 208
SinI GGWCC 2 cut(s) 79, 206
SmiMI CAYNNNNRTG 1 cut(s) 200
SseBI AGGCCT 1 cut(s) 112
SsiI CCGC 1 cut(s) 178
SspMI CTAG 2 cut(s) 21, 232
StuI AGGCCT 1 cut(s) 112
StyD4I CCNGG 1 cut(s) 208
TaaI ACNGT 1 cut(s) 83
TaqI TCGA 1 cut(s) 17
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TseFI GTSAC 1 cut(s) 83
Tsp45I GTSAC 1 cut(s) 83
TspDTI ATGAA 1 cut(s) 66
VpaK11BI GGWCC 2 cut(s) 79, 206
XspI CTAG 2 cut(s) 21, 232
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.