Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8402305.1

Orthogroup ID

OG0002786

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1219

Gene Structure 1219 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8402305.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 324 bp

atgatcacaaaagccacatttgtgggacctggttttacaaggaaacctcccaagtatgagcggtttatccggcccagtgggttgcgattcactaaagctcacgtgacacaccctgaactcaaatgtacttttaacctcgagatcattggtgtgaagaaaaaccctaatggtcaaatgtacacctctcttggtgtcttgaccaagggaaccatcattgaggtgaatgtaagtgaacttggtctagtcacacctaatgggaaagttgtatgggggaaatatgctcaggtgacgaataatccagagaacgatggatgtgtaaatgca

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ribosomal_S8e

Protein Analysis

108

Amino Acids

11.88

Weight (kDa)

9.7

Isoelectric Point (pI)

19.16

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002786)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G06360
fragaria_vesca	FvH4_1g24730 FvH4_1g24730 FvH4_1g24730 FvH4_1g24810
malus_domestica	MD05G1235300.v1.1 MD10G1211300.v1.1
prunus_persica	Prupe.4G241300_v2.0.a1
pyrus_communis	pycom05g21220 pycom10g17960
rosa_chinensis	RchiOBHm_Chr2g0122251 RchiOBHm_Chr4g0409741 RchiOBHm_Chr7g0216581 RchiOBHm_Chr7g0216591
rosa_laevigata	RLG00000008527 RLG00000018672
rosa_multiflora	Rmu_co8402305.1_g000001 Rmu_co8495649.1_g000001 Rmu_sc0002786.1_g000003 Rmu_sc0009638.1_g000011 Rmu_sc0009638.1_g000012
rosa_roxburghii	Rroxscaffold_2G00121730 Rroxscaffold_3G00243120 Rroxscaffold_5G00354300
rosa_rugosa	Rorug02G0237400 Rorug04G0096500
rosa_samantha	Rh2AG296500 Rh2BG305000 Rh2CG283400 Rh2DG320400 Rh4AG157900 Rh4CG168400 Rh4DG152300 Rh7AG300300 Rh7CG318800
rosa_wichuraiana	Rw2G023590 Rw4G012910 Rw4G013010 Rw7G025520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	61
AciI	CCGC	1 cut(s)	61
AcvI	CACGTG	1 cut(s)	103
AfaI	GTAC	2 cut(s)	127, 179
AjnI	CCWGG	1 cut(s)	28
AleI	CACNNNNGTG	1 cut(s)	20
AluBI	AGCT	1 cut(s)	98
AluI	AGCT	1 cut(s)	98
Ama87I	CYCGRG	1 cut(s)	137
AoxI	GGCC	1 cut(s)	71
AspS9I	GGNCC	2 cut(s)	26, 72
AsuHPI	GGTGA	2 cut(s)	232, 298
AvaI	CYCGRG	1 cut(s)	137
AvaII	GGWCC	1 cut(s)	26
BbrPI	CACGTG	1 cut(s)	103
BccI	CCATC	2 cut(s)	218, 302
BciT130I	CCWGG	1 cut(s)	30
BclI	TGATCA	1 cut(s)	3
BfaI	CTAG	1 cut(s)	242
Bme1390I	CCNGG	1 cut(s)	30
Bme18I	GGWCC	1 cut(s)	26
BmeT110I	CYCGRG	1 cut(s)	137
BmgT120I	GGNCC	2 cut(s)	26, 72
BmiI	GGNNCC	2 cut(s)	27, 208
BmrFI	CCNGG	1 cut(s)	30
BmrI	ACTGGG	1 cut(s)	69
BmuI	ACTGGG	1 cut(s)	69
Bpu10I	CCTNAGC	1 cut(s)	282
BsaAI	YACGTR	1 cut(s)	103
BsaJI	CCNNGG	1 cut(s)	201
Bse1I	ACTGG	1 cut(s)	75
BseBI	CCWGG	1 cut(s)	30
BseDI	CCNNGG	1 cut(s)	201
BseGI	GGATG	1 cut(s)	317
BseMII	CTCAG	1 cut(s)	296
BseNI	ACTGG	1 cut(s)	75
BshFI	GGCC	1 cut(s)	73
BsiHKCI	CYCGRG	1 cut(s)	137
BsiSI	CCGG	1 cut(s)	70
BslFI	GGGAC	1 cut(s)	39
BsmFI	GGGAC	1 cut(s)	39
BsnI	GGCC	1 cut(s)	73
BsoBI	CYCGRG	1 cut(s)	137
Bsp1407I	TGTACA	1 cut(s)	177
Bsp143I	GATC	2 cut(s)	3, 141
BspACI	CCGC	1 cut(s)	61
BspANI	GGCC	1 cut(s)	73
BspCNI	CTCAG	1 cut(s)	295
BspLI	GGNNCC	2 cut(s)	27, 208
BsrBI	CCGCTC	1 cut(s)	61
BsrGI	TGTACA	1 cut(s)	177
BsrI	ACTGG	1 cut(s)	75
BssECI	CCNNGG	1 cut(s)	201
BssMI	GATC	2 cut(s)	3, 141
BssT1I	CCWWGG	1 cut(s)	201
Bst2UI	CCWGG	1 cut(s)	30
BstAUI	TGTACA	1 cut(s)	177
BstBAI	YACGTR	1 cut(s)	103
BstDEI	CTNAG	1 cut(s)	282
BstF5I	GGATG	1 cut(s)	317
BstKTI	GATC	2 cut(s)	6, 144
BstMBI	GATC	2 cut(s)	3, 141
BstNI	CCWGG	1 cut(s)	30
BstSCI	CCNGG	1 cut(s)	28
BstXI	CCANNNNNNTGG	1 cut(s)	22
BsuRI	GGCC	1 cut(s)	73
BtsCI	GGATG	1 cut(s)	317
BtsIMutI	CAGTG	1 cut(s)	82
Cfr13I	GGNCC	2 cut(s)	26, 72
CsiI	ACCWGGT	1 cut(s)	28
Csp6I	GTAC	2 cut(s)	126, 178
CviJI	RGCY	3 cut(s)	14, 73, 98
CviKI_1	RGCY	3 cut(s)	14, 73, 98
CviQI	GTAC	2 cut(s)	126, 178
DdeI	CTNAG	1 cut(s)	282
DpnI	GATC	2 cut(s)	5, 143
DpnII	GATC	2 cut(s)	3, 141
Eco130I	CCWWGG	1 cut(s)	201
Eco47I	GGWCC	1 cut(s)	26
Eco72I	CACGTG	1 cut(s)	103
Eco88I	CYCGRG	1 cut(s)	137
EcoO109I	RGGNCCY	1 cut(s)	26
EcoRII	CCWGG	1 cut(s)	28
EcoT14I	CCWWGG	1 cut(s)	201
ErhI	CCWWGG	1 cut(s)	201
FaiI	YATR	3 cut(s)	57, 268, 279
FaqI	GGGAC	1 cut(s)	39
FbaI	TGATCA	1 cut(s)	3
FspBI	CTAG	1 cut(s)	242
HaeIII	GGCC	1 cut(s)	73
HapII	CCGG	1 cut(s)	70
HinfI	GANTC	1 cut(s)	87
HpaII	CCGG	1 cut(s)	70
HphI	GGTGA	2 cut(s)	232, 298
Hpy166II	GTNNAC	2 cut(s)	180, 233
Hpy188III	TCNNGA	3 cut(s)	139, 196, 299
Hpy8I	GTNNAC	2 cut(s)	180, 233
HpyCH4IV	ACGT	1 cut(s)	102
HpyCH4V	TGCA	1 cut(s)	323
HpyF3I	CTNAG	1 cut(s)	282
HpySE526I	ACGT	1 cut(s)	102
Ksp22I	TGATCA	1 cut(s)	3
Kzo9I	GATC	2 cut(s)	3, 141
LpnPI	CCDG	7 cut(s)	15, 42, 83, 88, 126, 269, 312
MabI	ACCWGGT	1 cut(s)	28
MaeI	CTAG	1 cut(s)	242
MaeII	ACGT	1 cut(s)	102
MaeIII	GTNAC	3 cut(s)	103, 244, 286
MalI	GATC	2 cut(s)	5, 143
MbiI	CCGCTC	1 cut(s)	61
MboI	GATC	2 cut(s)	3, 141
MboII	GAAGA	1 cut(s)	166
MnlI	CCTC	4 cut(s)	57, 146, 193, 211
MseI	TTAA	1 cut(s)	132
MslI	CAYNNNNRTG	3 cut(s)	20, 149, 218
MspI	CCGG	1 cut(s)	70
MspR9I	CCNGG	1 cut(s)	30
MvaI	CCWGG	1 cut(s)	30
NdeII	GATC	2 cut(s)	3, 141
NlaIV	GGNNCC	2 cut(s)	27, 208
NmuCI	GTSAC	3 cut(s)	103, 244, 286
OliI	CACNNNNGTG	1 cut(s)	20
PaeR7I	CTCGAG	1 cut(s)	137
PfeI	GAWTC	1 cut(s)	87
PmaCI	CACGTG	1 cut(s)	103
PmlI	CACGTG	1 cut(s)	103
Ppu21I	YACGTR	1 cut(s)	103
PpuMI	RGGWCCY	1 cut(s)	26
Psp5II	RGGWCCY	1 cut(s)	26
Psp6I	CCWGG	1 cut(s)	28
PspCI	CACGTG	1 cut(s)	103
PspGI	CCWGG	1 cut(s)	28
PspN4I	GGNNCC	2 cut(s)	27, 208
PspPI	GGNCC	2 cut(s)	26, 72
PspPPI	RGGWCCY	1 cut(s)	26
RsaI	GTAC	2 cut(s)	127, 179
RsaNI	GTAC	2 cut(s)	126, 178
RseI	CAYNNNNRTG	3 cut(s)	20, 149, 218
SaqAI	TTAA	1 cut(s)	132
Sau3AI	GATC	2 cut(s)	3, 141
Sau96I	GGNCC	2 cut(s)	26, 72
ScrFI	CCNGG	1 cut(s)	30
SetI	ASST	9 cut(s)	31, 49, 100, 105, 138, 185, 222, 253, 288
SexAI	ACCWGGT	1 cut(s)	28
Sfr274I	CTCGAG	1 cut(s)	137
SinI	GGWCC	1 cut(s)	26
SlaI	CTCGAG	1 cut(s)	137
SmiMI	CAYNNNNRTG	3 cut(s)	20, 149, 218
SmlI	CTYRAG	1 cut(s)	137
SmoI	CTYRAG	1 cut(s)	137
SsiI	CCGC	1 cut(s)	61
SspMI	CTAG	1 cut(s)	242
StyD4I	CCNGG	1 cut(s)	28
StyI	CCWWGG	1 cut(s)	201
TaiI	ACGT	1 cut(s)	105
TaqI	TCGA	1 cut(s)	138
TatI	WGTACW	2 cut(s)	125, 177
TfiI	GAWTC	1 cut(s)	87
Tru1I	TTAA	1 cut(s)	132
Tru9I	TTAA	1 cut(s)	132
TscAI	CASTG	1 cut(s)	82
TseFI	GTSAC	3 cut(s)	103, 244, 286
Tsp45I	GTSAC	3 cut(s)	103, 244, 286
TspRI	CASTG	1 cut(s)	82
VpaK11BI	GGWCC	1 cut(s)	26
XhoI	CTCGAG	1 cut(s)	137
XspI	CTAG	1 cut(s)	242

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.