Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0009638.1

Orthogroup ID

OG0002786

Physical Location & Seq

Genomic Coordinates Forward (+)

45490 .. 46225

Gene Structure 736 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0009638.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 252 bp

atgttgacggattggccatgcatgaggagtcatcgactaggcacaaaggttgatgatgatgatgtccatgaaggagttgttccaacattgatgttggatcgtgacaatacaacacgagcaaaggtgaggtctgtggctgaagatgagatgtttaatgtgcttagaacccacaaacgcaagactaagcaatggaagtggatgatcacaaaagctacagttgtgggacgtggttttacaaggaaacctccctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ribosomal_S8e

Protein Analysis

83

Amino Acids

9.72

Weight (kDa)

10.0

Isoelectric Point (pI)

34.58

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002786)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G06360
fragaria_vesca	FvH4_1g24730 FvH4_1g24730 FvH4_1g24730 FvH4_1g24810
malus_domestica	MD05G1235300.v1.1 MD10G1211300.v1.1
prunus_persica	Prupe.4G241300_v2.0.a1
pyrus_communis	pycom05g21220 pycom10g17960
rosa_chinensis	RchiOBHm_Chr2g0122251 RchiOBHm_Chr4g0409741 RchiOBHm_Chr7g0216581 RchiOBHm_Chr7g0216591
rosa_laevigata	RLG00000008527 RLG00000018672
rosa_multiflora	Rmu_co8402305.1_g000001 Rmu_co8495649.1_g000001 Rmu_sc0002786.1_g000003 Rmu_sc0009638.1_g000011 Rmu_sc0009638.1_g000012
rosa_roxburghii	Rroxscaffold_2G00121730 Rroxscaffold_3G00243120 Rroxscaffold_5G00354300
rosa_rugosa	Rorug02G0237400 Rorug04G0096500
rosa_samantha	Rh2AG296500 Rh2BG305000 Rh2CG283400 Rh2DG320400 Rh4AG157900 Rh4CG168400 Rh4DG152300 Rh7AG300300 Rh7CG318800
rosa_wichuraiana	Rw2G023590 Rw4G012910 Rw4G013010 Rw7G025520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	105
AcoI	YGGCCR	1 cut(s)	14
AcuI	CTGAAG	1 cut(s)	159
AjiI	CACGTC	1 cut(s)	227
AluBI	AGCT	1 cut(s)	212
AluI	AGCT	1 cut(s)	212
AlwI	GGATC	1 cut(s)	105
AoxI	GGCC	1 cut(s)	14
ArsI	GACNNNNNNTTYG	2 cut(s)	113, 145
AsuHPI	GGTGA	1 cut(s)	136
BalI	TGGCCA	1 cut(s)	16
BauI	CACGAG	1 cut(s)	114
BclI	TGATCA	1 cut(s)	201
BfaI	CTAG	2 cut(s)	38, 250
BfmI	CTRYAG	1 cut(s)	213
BmgBI	CACGTC	1 cut(s)	227
Bse3DI	GCAATG	1 cut(s)	194
BseGI	GGATG	1 cut(s)	204
BseMI	GCAATG	1 cut(s)	194
BseRI	GAGGAG	1 cut(s)	40
BshFI	GGCC	1 cut(s)	16
BslFI	GGGAC	1 cut(s)	237
BsmFI	GGGAC	1 cut(s)	237
BsnI	GGCC	1 cut(s)	16
Bsp143I	GATC	2 cut(s)	97, 201
BspANI	GGCC	1 cut(s)	16
BspPI	GGATC	1 cut(s)	105
BsrDI	GCAATG	1 cut(s)	194
BssMI	GATC	2 cut(s)	97, 201
BssSI	CACGAG	1 cut(s)	114
Bst2BI	CACGAG	1 cut(s)	114
Bst4CI	ACNGT	1 cut(s)	217
BstDEI	CTNAG	2 cut(s)	161, 183
BstF5I	GGATG	1 cut(s)	204
BstKTI	GATC	2 cut(s)	100, 204
BstMBI	GATC	2 cut(s)	97, 201
BstSFI	CTRYAG	1 cut(s)	213
BsuRI	GGCC	1 cut(s)	16
BtrI	CACGTC	1 cut(s)	227
BtsCI	GGATG	1 cut(s)	204
CspCI	CAANNNNNGTGG	2 cut(s)	176, 211
CviAII	CATG	3 cut(s)	18, 22, 68
CviJI	RGCY	3 cut(s)	16, 137, 212
CviKI_1	RGCY	3 cut(s)	16, 137, 212
DdeI	CTNAG	2 cut(s)	161, 183
DpnI	GATC	2 cut(s)	99, 203
DpnII	GATC	2 cut(s)	97, 201
EaeI	YGGCCR	1 cut(s)	14
Eco57I	CTGAAG	1 cut(s)	159
EcoT22I	ATGCAT	1 cut(s)	23
FaeI	CATG	3 cut(s)	21, 25, 71
FaiI	YATR	3 cut(s)	19, 23, 69
FaqI	GGGAC	1 cut(s)	237
FatI	CATG	3 cut(s)	17, 21, 67
FbaI	TGATCA	1 cut(s)	201
FokI	GGATG	1 cut(s)	211
FspBI	CTAG	2 cut(s)	38, 250
HaeIII	GGCC	1 cut(s)	16
Hin1II	CATG	3 cut(s)	21, 25, 71
HincII	GTYRAC	1 cut(s)	6
HindII	GTYRAC	1 cut(s)	6
HinfI	GANTC	1 cut(s)	28
HphI	GGTGA	1 cut(s)	136
Hpy166II	GTNNAC	1 cut(s)	6
Hpy188III	TCNNGA	1 cut(s)	101
Hpy8I	GTNNAC	1 cut(s)	6
HpyAV	CCTTC	1 cut(s)	65
HpyCH4III	ACNGT	1 cut(s)	217
HpyCH4IV	ACGT	1 cut(s)	226
HpyCH4V	TGCA	1 cut(s)	21
HpyF3I	CTNAG	2 cut(s)	161, 183
HpySE526I	ACGT	1 cut(s)	226
Hsp92II	CATG	3 cut(s)	21, 25, 71
Ksp22I	TGATCA	1 cut(s)	201
Kzo9I	GATC	2 cut(s)	97, 201
MaeI	CTAG	2 cut(s)	38, 250
MaeII	ACGT	1 cut(s)	226
MaeIII	GTNAC	1 cut(s)	101
MalI	GATC	2 cut(s)	99, 203
MboI	GATC	2 cut(s)	97, 201
MboII	GAAGA	1 cut(s)	152
MlsI	TGGCCA	1 cut(s)	16
MluNI	TGGCCA	1 cut(s)	16
MlyI	GAGTC	1 cut(s)	37
MmeI	TCCRAC	2 cut(s)	75, 107
MnlI	CCTC	2 cut(s)	18, 120
Mox20I	TGGCCA	1 cut(s)	16
Mph1103I	ATGCAT	1 cut(s)	23
MscI	TGGCCA	1 cut(s)	16
MseI	TTAA	1 cut(s)	153
Msp20I	TGGCCA	1 cut(s)	16
NdeII	GATC	2 cut(s)	97, 201
NlaIII	CATG	3 cut(s)	21, 25, 71
NmuCI	GTSAC	1 cut(s)	101
NsiI	ATGCAT	1 cut(s)	23
PleI	GAGTC	1 cut(s)	36
PpsI	GAGTC	1 cut(s)	36
SaqAI	TTAA	1 cut(s)	153
Sau3AI	GATC	2 cut(s)	97, 201
SchI	GAGTC	1 cut(s)	37
SetI	ASST	6 cut(s)	51, 126, 131, 214, 229, 247
SfcI	CTRYAG	1 cut(s)	213
SgeI	CNNG	9 cut(s)	30, 34, 50, 80, 113, 126, 128, 190, 239
SspMI	CTAG	2 cut(s)	38, 250
TaaI	ACNGT	1 cut(s)	217
TaiI	ACGT	1 cut(s)	229
TaqI	TCGA	1 cut(s)	34
Tru1I	TTAA	1 cut(s)	153
Tru9I	TTAA	1 cut(s)	153
TseFI	GTSAC	1 cut(s)	101
Tsp45I	GTSAC	1 cut(s)	101
TspDTI	ATGAA	1 cut(s)	84
TspGWI	ACGGA	1 cut(s)	23
XspI	CTAG	2 cut(s)	38, 250
Zsp2I	ATGCAT	1 cut(s)	23

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.