Rw4G012910

Ribosome biogenesis protein NSA2 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
OG0002786
Physical Location & Seq
Forward (+)
30293136 .. 30295700
2565 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G012910.1

Sequence Viewer

Length: 771 bp
ATGCCCCAGAAAATTGGAAAGAAGCGATATGGGTACAGACCTGACCACTTTGAGCGCAAGCGCAAGAAGGAGGCTCGTGAGGTCCACAAGCGCTCTGAAATCGCACAAAAGGCTCTGGGTATTAAAGGCAAGATGTTTGCCAAGAAACGCTATGCAGAAAAGGCTCTAATGAAGAAAACATTGGCTATGCATGAGGAGTCATCGACTAGGCACAAGGTTGATGATGATGTTCATGAAGGAGCTGTTCCAACATATTTGTTGGATCGTGACAATACAACACGAGCAAAGACTCTTAGCAATTCCATCAAGCAAAAACGAAAAGAGAAAGCTGGGAAATGGGAAGTCCCTCTGCCTAAGGTAAGGCCTGTGGCTGAAGATGAGATGTTTAAAGTGCTTCGAACGGGCAAACGCAAGACTAAGCAATGGAAGCGGATGATCACAAAAGCCACATTTGTGGGACCTGGTTTTACCAGGAAACCTCCCAAATATGAGCGATTTATCCGGCCCAGTGGATTGCGATTCACTAAAGCTCATGTGACACACCCTGAACTCAAATGTACTTTTAACCTTGAGATTATCGGTGTGAAGAAAAACCCCAATGGTCAAATGTACACCTCTCTTGGTGTCTTGACCAAGGGAACCATCATTGAGGTGAATGTAAGTGAACTTGGTCTTGTCACACCTAACGGGAAAGTTGTATGGGGGAAATATGCTCAGGTGACAAATAATCCGGAGAACGATGGATGTGTAAATGCAGTTCTGCTTGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ribosomal_S8e

Protein Analysis

256

Amino Acids

29.29

Weight (kDa)

10.21

Isoelectric Point (pI)

37.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S8e PF01201 31 - 255 3.6e-41 Ribosomal protein S8e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 730
AciI CCGC 1 cut(s) 430
AclWI GGATC 1 cut(s) 270
AcuI CTGAAG 1 cut(s) 393
AfaI GTAC 3 cut(s) 35, 559, 611
AfeI AGCGCT 1 cut(s) 92
AjnI CCWGG 2 cut(s) 460, 470
AjuI GAANNNNNNNTTGG 2 cut(s) 164, 196
AleI CACNNNNGTG 1 cut(s) 452
AluBI AGCT 3 cut(s) 242, 329, 530
AluI AGCT 3 cut(s) 242, 329, 530
AlwI GGATC 1 cut(s) 270
Aor13HI TCCGGA 1 cut(s) 730
Aor51HI AGCGCT 1 cut(s) 92
AoxI GGCC 2 cut(s) 362, 503
AspLEI GCGC 3 cut(s) 57, 63, 93
AspS9I GGNCC 3 cut(s) 82, 458, 504
AsuHPI GGTGA 2 cut(s) 664, 730
AsuII TTCGAA 1 cut(s) 397
AvaII GGWCC 2 cut(s) 82, 458
AxyI CCTNAGG 1 cut(s) 354
BauI CACGAG 2 cut(s) 75, 279
BccI CCATC 3 cut(s) 311, 650, 734
BciT130I CCWGG 2 cut(s) 462, 472
BclI TGATCA 1 cut(s) 435
BfaI CTAG 1 cut(s) 207
BfoI RGCGCY 1 cut(s) 94
Bme1390I CCNGG 2 cut(s) 462, 472
Bme18I GGWCC 2 cut(s) 82, 458
BmgT120I GGNCC 3 cut(s) 82, 458, 504
BmiI GGNNCC 2 cut(s) 459, 640
BmrFI CCNGG 2 cut(s) 462, 472
BmrI ACTGGG 1 cut(s) 501
BmuI ACTGGG 1 cut(s) 501
Bpu10I CCTNAGC 1 cut(s) 714
Bpu14I TTCGAA 1 cut(s) 397
BpuEI CTTGAG 1 cut(s) 590
BsaJI CCNNGG 1 cut(s) 633
BsaWI WCCGGW 1 cut(s) 730
Bse1I ACTGG 1 cut(s) 507
Bse21I CCTNAGG 1 cut(s) 354
Bse3DI GCAATG 1 cut(s) 428
BseAI TCCGGA 1 cut(s) 730
BseBI CCWGG 2 cut(s) 462, 472
BseDI CCNNGG 1 cut(s) 633
BseGI GGATG 2 cut(s) 438, 749
BseMI GCAATG 1 cut(s) 428
BseMII CTCAG 1 cut(s) 728
BseNI ACTGG 1 cut(s) 507
BseRI GAGGAG 1 cut(s) 209
BseYI CCCAGC 1 cut(s) 329
BshFI GGCC 2 cut(s) 364, 505
BsiSI CCGG 2 cut(s) 502, 731
BslFI GGGAC 2 cut(s) 329, 471
BsmFI GGGAC 2 cut(s) 329, 471
BsnI GGCC 2 cut(s) 364, 505
Bsp119I TTCGAA 1 cut(s) 397
Bsp13I TCCGGA 1 cut(s) 730
Bsp1407I TGTACA 1 cut(s) 609
Bsp143I GATC 2 cut(s) 262, 435
BspACI CCGC 1 cut(s) 430
BspANI GGCC 2 cut(s) 364, 505
BspCNI CTCAG 1 cut(s) 727
BspEI TCCGGA 1 cut(s) 730
BspHI TCATGA 1 cut(s) 232
BspLI GGNNCC 2 cut(s) 459, 640
BspPI GGATC 1 cut(s) 270
BspT104I TTCGAA 1 cut(s) 397
BsrDI GCAATG 1 cut(s) 428
BsrGI TGTACA 1 cut(s) 609
BsrI ACTGG 1 cut(s) 507
BssECI CCNNGG 1 cut(s) 633
BssMI GATC 2 cut(s) 262, 435
BssSI CACGAG 2 cut(s) 75, 279
BssT1I CCWWGG 1 cut(s) 633
Bst2BI CACGAG 2 cut(s) 75, 279
Bst2UI CCWGG 2 cut(s) 462, 472
BstAUI TGTACA 1 cut(s) 609
BstBI TTCGAA 1 cut(s) 397
BstC8I GCNNGC 1 cut(s) 59
BstDEI CTNAG 4 cut(s) 293, 354, 417, 714
BstF5I GGATG 2 cut(s) 438, 749
BstH2I RGCGCY 1 cut(s) 94
BstHHI GCGC 3 cut(s) 57, 63, 93
BstKTI GATC 2 cut(s) 265, 438
BstMBI GATC 2 cut(s) 262, 435
BstMWI GCNNNNNNNGC 3 cut(s) 110, 161, 427
BstNI CCWGG 2 cut(s) 462, 472
BstSCI CCNGG 2 cut(s) 460, 470
BstXI CCANNNNNNTGG 2 cut(s) 14, 454
Bsu36I CCTNAGG 1 cut(s) 354
BsuRI GGCC 2 cut(s) 364, 505
BtsCI GGATG 2 cut(s) 438, 749
BtsIMutI CAGTG 1 cut(s) 514
Cac8I GCNNGC 1 cut(s) 59
CciI TCATGA 1 cut(s) 232
CfoI GCGC 3 cut(s) 57, 63, 93
Cfr13I GGNCC 3 cut(s) 82, 458, 504
CsiI ACCWGGT 1 cut(s) 460
Csp6I GTAC 3 cut(s) 34, 558, 610
CviAII CATG 3 cut(s) 191, 233, 533
CviQI GTAC 3 cut(s) 34, 558, 610
DdeI CTNAG 4 cut(s) 293, 354, 417, 714
DpnI GATC 2 cut(s) 264, 437
DpnII GATC 2 cut(s) 262, 435
DraI TTTAAA 1 cut(s) 388
Eco130I CCWWGG 1 cut(s) 633
Eco147I AGGCCT 1 cut(s) 364
Eco47I GGWCC 2 cut(s) 82, 458
Eco47III AGCGCT 1 cut(s) 92
Eco57I CTGAAG 1 cut(s) 393
Eco81I CCTNAGG 1 cut(s) 354
EcoO109I RGGNCCY 1 cut(s) 458
EcoRII CCWGG 2 cut(s) 460, 470
EcoT14I CCWWGG 1 cut(s) 633
EcoT22I ATGCAT 1 cut(s) 192
ErhI CCWWGG 1 cut(s) 633
FaeI CATG 3 cut(s) 194, 236, 536
FaqI GGGAC 2 cut(s) 329, 471
FatI CATG 3 cut(s) 190, 232, 532
FbaI TGATCA 1 cut(s) 435
FokI GGATG 2 cut(s) 445, 756
FspBI CTAG 1 cut(s) 207
GlaI GCGC 3 cut(s) 56, 62, 92
GsaI CCCAGC 1 cut(s) 333
HaeII RGCGCY 1 cut(s) 94
HaeIII GGCC 2 cut(s) 364, 505
HapII CCGG 2 cut(s) 502, 731
HhaI GCGC 3 cut(s) 57, 63, 93
Hin1II CATG 3 cut(s) 194, 236, 536
Hin6I GCGC 3 cut(s) 55, 61, 91
HinP1I GCGC 3 cut(s) 55, 61, 91
HinfI GANTC 3 cut(s) 197, 289, 519
HpaII CCGG 2 cut(s) 502, 731
HphI GGTGA 2 cut(s) 664, 730
Hpy166II GTNNAC 3 cut(s) 85, 612, 665
Hpy188I TCNGA 1 cut(s) 97
Hpy188III TCNNGA 5 cut(s) 77, 233, 266, 628, 731
Hpy8I GTNNAC 3 cut(s) 85, 612, 665
HpyAV CCTTC 2 cut(s) 61, 230
HpyCH4V TGCA 3 cut(s) 155, 190, 755
HpyF10VI GCNNNNNNNGC 3 cut(s) 110, 161, 427
HpyF3I CTNAG 4 cut(s) 293, 354, 417, 714
Hsp92II CATG 3 cut(s) 194, 236, 536
HspAI GCGC 3 cut(s) 55, 61, 91
Kpn2I TCCGGA 1 cut(s) 730
Ksp22I TGATCA 1 cut(s) 435
Kzo9I GATC 2 cut(s) 262, 435
LmnI GCTCC 1 cut(s) 239
MabI ACCWGGT 1 cut(s) 460
MaeI CTAG 1 cut(s) 207
MaeIII GTNAC 4 cut(s) 266, 535, 676, 718
MalI GATC 2 cut(s) 264, 437
MboI GATC 2 cut(s) 262, 435
MboII GAAGA 3 cut(s) 184, 386, 598
MluCI AATT 2 cut(s) 12, 298
MlyI GAGTC 2 cut(s) 206, 283
MmeI TCCRAC 2 cut(s) 240, 272
MnlI CCTC 7 cut(s) 64, 73, 187, 357, 489, 625, 643
Mph1103I ATGCAT 1 cut(s) 192
MroI TCCGGA 1 cut(s) 730
MseI TTAA 3 cut(s) 123, 387, 564
MslI CAYNNNNRTG 2 cut(s) 452, 650
MspI CCGG 2 cut(s) 502, 731
MspR9I CCNGG 2 cut(s) 462, 472
MvaI CCWGG 2 cut(s) 462, 472
MwoI GCNNNNNNNGC 3 cut(s) 110, 161, 427
NdeII GATC 2 cut(s) 262, 435
NlaIII CATG 3 cut(s) 194, 236, 536
NlaIV GGNNCC 2 cut(s) 459, 640
NmuCI GTSAC 4 cut(s) 266, 535, 676, 718
NsiI ATGCAT 1 cut(s) 192
NspV TTCGAA 1 cut(s) 397
OliI CACNNNNGTG 1 cut(s) 452
PagI TCATGA 1 cut(s) 232
PceI AGGCCT 1 cut(s) 364
PfeI GAWTC 1 cut(s) 519
PleI GAGTC 2 cut(s) 205, 283
PpsI GAGTC 2 cut(s) 205, 283
PpuMI RGGWCCY 1 cut(s) 458
Psp5II RGGWCCY 1 cut(s) 458
Psp6I CCWGG 2 cut(s) 460, 470
PspFI CCCAGC 1 cut(s) 329
PspGI CCWGG 2 cut(s) 460, 470
PspN4I GGNNCC 2 cut(s) 459, 640
PspPI GGNCC 3 cut(s) 82, 458, 504
PspPPI RGGWCCY 1 cut(s) 458
PsrI GAACNNNNNNTAC 1 cut(s) 741
RsaI GTAC 3 cut(s) 35, 559, 611
RsaNI GTAC 3 cut(s) 34, 558, 610
RseI CAYNNNNRTG 2 cut(s) 452, 650
SaqAI TTAA 3 cut(s) 123, 387, 564
Sau3AI GATC 2 cut(s) 262, 435
Sau96I GGNCC 3 cut(s) 82, 458, 504
SchI GAGTC 2 cut(s) 206, 283
ScrFI CCNGG 2 cut(s) 462, 472
SexAI ACCWGGT 1 cut(s) 460
SfuI TTCGAA 1 cut(s) 397
SinI GGWCC 2 cut(s) 82, 458
SmiMI CAYNNNNRTG 2 cut(s) 452, 650
SmlI CTYRAG 1 cut(s) 569
SmoI CTYRAG 1 cut(s) 569
Sse9I AATT 2 cut(s) 12, 298
SseBI AGGCCT 1 cut(s) 364
SsiI CCGC 1 cut(s) 430
SspMI CTAG 1 cut(s) 207
StuI AGGCCT 1 cut(s) 364
StyD4I CCNGG 2 cut(s) 460, 470
StyI CCWWGG 1 cut(s) 633
TaqI TCGA 2 cut(s) 203, 397
TasI AATT 2 cut(s) 12, 298
TatI WGTACW 2 cut(s) 557, 609
TfiI GAWTC 1 cut(s) 519
Tru1I TTAA 3 cut(s) 123, 387, 564
Tru9I TTAA 3 cut(s) 123, 387, 564
TscAI CASTG 1 cut(s) 514
TseFI GTSAC 4 cut(s) 266, 535, 676, 718
Tsp45I GTSAC 4 cut(s) 266, 535, 676, 718
TspDTI ATGAA 3 cut(s) 185, 221, 249
TspRI CASTG 1 cut(s) 514
VpaK11BI GGWCC 2 cut(s) 82, 458
XspI CTAG 1 cut(s) 207
Zsp2I ATGCAT 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.