RLG00000004049

Protein of unknown function (DUF632)

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
Physical Location & Seq
Reverse (-)
55641779 .. 55643093
1315 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000004049

Sequence Viewer

Length: 486 bp
ATGCTAAAGAGCGATGCAGTCAAACTTTGCCAGGAAAACAATTTTAATGCTGGGTTCTTTAAGGGTAGTGACAATAACGACATAGCTGATGCTTATGAATTGAAGAGTACCCACCTCTTTGAACATAAATGTGATAGTGAAGATTTCAACATCACCAACATCTTTGATGAAGCTGTTGAGTTTATTGATCCTGTTGAAGAAACAGGAGGGAAGGTTCTAGTCCATTGCTTTGAGGGAAAAAGTAGAAGTGCTACGAATTCCACTCTATTAGAAGCATGGAATGTTCTGCTTGAAGCTGAACTTCAAAACTGGCGTGCTTGCTTTGCATCATACTTTTCTTCCCAGAAGGCGTACATTGAAGCTCTTCATGGTTGGCTGTTAAAGTTTGTTGCCCCTGAAACTGAATTCTACTTGAAGGGCATGTCTCCACTTCCATCATGTACACTAAACGGGCCACCATTACTTGCAATCTATAATAACTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

162

Amino Acids

18.19

Weight (kDa)

4.68

Isoelectric Point (pI)

47.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DSPc PF00782 33 - 85 3.7e-11 Dual specificity phosphatase, catalytic domain
DUF632 PF04782 91 - 161 1.4e-13 Protein of unknown function (DUF632)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 182
AcsI RAATTY 2 cut(s) 256, 404
AfaI GTAC 3 cut(s) 109, 353, 442
AgsI TTSAA 8 cut(s) 103, 122, 148, 197, 293, 305, 359, 415
AjnI CCWGG 1 cut(s) 30
AloI GAACNNNNNNTCC 2 cut(s) 198, 230
AluBI AGCT 4 cut(s) 86, 173, 296, 362
AluI AGCT 4 cut(s) 86, 173, 296, 362
Alw26I GTCTC 1 cut(s) 429
AlwI GGATC 1 cut(s) 182
AoxI GGCC 1 cut(s) 452
ApoI RAATTY 2 cut(s) 256, 404
Asp700I GAANNNNTTC 1 cut(s) 363
AspS9I GGNCC 1 cut(s) 452
AsuHPI GGTGA 1 cut(s) 145
BccI CCATC 1 cut(s) 442
BciT130I CCWGG 1 cut(s) 32
BcoDI GTCTC 1 cut(s) 429
BfaI CTAG 1 cut(s) 218
Bme1390I CCNGG 1 cut(s) 32
BmgT120I GGNCC 1 cut(s) 452
BmrFI CCNGG 1 cut(s) 32
BmsI GCATC 3 cut(s) 4, 79, 335
BsaXI ACNNNNNCTCC 2 cut(s) 198, 228
Bse1I ACTGG 2 cut(s) 314, 485
Bse3DI GCAATG 1 cut(s) 223
BseBI CCWGG 1 cut(s) 32
BseMI GCAATG 1 cut(s) 223
BseNI ACTGG 2 cut(s) 314, 485
BseYI CCCAGC 1 cut(s) 50
BshFI GGCC 1 cut(s) 454
BsmAI GTCTC 1 cut(s) 429
BsnI GGCC 1 cut(s) 454
Bsp1407I TGTACA 1 cut(s) 440
Bsp143I GATC 1 cut(s) 187
BspANI GGCC 1 cut(s) 454
BspPI GGATC 1 cut(s) 182
BspQI GCTCTTC 1 cut(s) 369
BsrDI GCAATG 1 cut(s) 223
BsrGI TGTACA 1 cut(s) 440
BsrI ACTGG 2 cut(s) 314, 485
BssMI GATC 1 cut(s) 187
Bst2UI CCWGG 1 cut(s) 32
Bst6I CTCTTC 2 cut(s) 98, 369
BstAUI TGTACA 1 cut(s) 440
BstC8I GCNNGC 2 cut(s) 315, 319
BstKTI GATC 1 cut(s) 190
BstMAI GTCTC 1 cut(s) 429
BstMBI GATC 1 cut(s) 187
BstMWI GCNNNNNNNGC 1 cut(s) 323
BstNI CCWGG 1 cut(s) 32
BstNSI RCATGY 1 cut(s) 424
BstSCI CCNGG 1 cut(s) 30
BsuRI GGCC 1 cut(s) 454
BtgZI GCGATG 1 cut(s) 27
Cac8I GCNNGC 2 cut(s) 315, 319
Cfr13I GGNCC 1 cut(s) 452
Csp6I GTAC 3 cut(s) 108, 352, 441
CviAII CATG 4 cut(s) 276, 368, 421, 438
CviJI RGCY 6 cut(s) 86, 173, 296, 362, 376, 454
CviKI_1 RGCY 6 cut(s) 86, 173, 296, 362, 376, 454
CviQI GTAC 3 cut(s) 108, 352, 441
DpnI GATC 1 cut(s) 189
DpnII GATC 1 cut(s) 187
Eam1104I CTCTTC 2 cut(s) 98, 369
EarI CTCTTC 2 cut(s) 98, 369
EcoRI GAATTC 2 cut(s) 256, 404
EcoRII CCWGG 1 cut(s) 30
FaeI CATG 4 cut(s) 279, 371, 424, 441
FaiI YATR 9 cut(s) 83, 96, 126, 277, 331, 369, 422, 439, 474
FalI AAGNNNNNCTT 2 cut(s) 285, 317
FatI CATG 4 cut(s) 275, 367, 420, 437
FspBI CTAG 1 cut(s) 218
GsaI CCCAGC 1 cut(s) 54
HaeIII GGCC 1 cut(s) 454
Hin1II CATG 4 cut(s) 279, 371, 424, 441
HphI GGTGA 1 cut(s) 145
Hpy166II GTNNAC 1 cut(s) 443
Hpy8I GTNNAC 1 cut(s) 443
HpyAV CCTTC 3 cut(s) 205, 340, 409
HpyCH4V TGCA 3 cut(s) 17, 326, 467
HpyF10VI GCNNNNNNNGC 1 cut(s) 323
Hsp92II CATG 4 cut(s) 279, 371, 424, 441
Kzo9I GATC 1 cut(s) 187
LguI GCTCTTC 1 cut(s) 369
LpnPI CCDG 9 cut(s) 17, 36, 44, 189, 204, 295, 356, 408, 466
LweI GCATC 3 cut(s) 4, 79, 335
MaeI CTAG 1 cut(s) 218
MaeIII GTNAC 1 cut(s) 68
MalI GATC 1 cut(s) 189
MboI GATC 1 cut(s) 187
MboII GAAGA 5 cut(s) 115, 152, 209, 330, 356
MluCI AATT 4 cut(s) 40, 98, 256, 404
MnlI CCTC 3 cut(s) 125, 200, 226
MroXI GAANNNNTTC 1 cut(s) 363
MseI TTAA 3 cut(s) 45, 60, 380
MslI CAYNNNNRTG 1 cut(s) 129
MspR9I CCNGG 1 cut(s) 32
MvaI CCWGG 1 cut(s) 32
MwoI GCNNNNNNNGC 1 cut(s) 323
NdeII GATC 1 cut(s) 187
NlaIII CATG 4 cut(s) 279, 371, 424, 441
NmuCI GTSAC 1 cut(s) 68
NspI RCATGY 1 cut(s) 424
PciSI GCTCTTC 1 cut(s) 369
PdmI GAANNNNTTC 1 cut(s) 363
Psp6I CCWGG 1 cut(s) 30
PspFI CCCAGC 1 cut(s) 50
PspGI CCWGG 1 cut(s) 30
PspPI GGNCC 1 cut(s) 452
RsaI GTAC 3 cut(s) 109, 353, 442
RsaNI GTAC 3 cut(s) 108, 352, 441
RseI CAYNNNNRTG 1 cut(s) 129
SapI GCTCTTC 1 cut(s) 369
SaqAI TTAA 3 cut(s) 45, 60, 380
Sau3AI GATC 1 cut(s) 187
Sau96I GGNCC 1 cut(s) 452
ScrFI CCNGG 1 cut(s) 32
SetI ASST 6 cut(s) 88, 117, 175, 216, 298, 364
SfaNI GCATC 3 cut(s) 4, 79, 335
SmiMI CAYNNNNRTG 1 cut(s) 129
Sse9I AATT 4 cut(s) 40, 98, 256, 404
SspMI CTAG 1 cut(s) 218
StyD4I CCNGG 1 cut(s) 30
TasI AATT 4 cut(s) 40, 98, 256, 404
TatI WGTACW 1 cut(s) 440
Tru1I TTAA 3 cut(s) 45, 60, 380
Tru9I TTAA 3 cut(s) 45, 60, 380
TseFI GTSAC 1 cut(s) 68
Tsp45I GTSAC 1 cut(s) 68
TspDTI ATGAA 3 cut(s) 111, 183, 356
XapI RAATTY 2 cut(s) 256, 404
XceI RCATGY 1 cut(s) 424
XmnI GAANNNNTTC 1 cut(s) 363
XspI CTAG 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.