Rh7DG144200

dual specificity protein phosphatase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
12291671 .. 12292591
921 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG144200.1

Sequence Viewer

Length: 207 bp
ATGCTAAAGAGCGATGCAGTGAAACTTTGCCAGGAAAACAATTTAAATGCTAGGTTCTTTGAGGGTAGTGACAATAACGGCATAGTTGACGCTTATGAATTGAAGACTACCCACCTCTTTGAACATATATATGACAGTGAAGATTTCAACATCACCAACATCTTTGATGAAGCTGTTGAGTTTATTGATCATGTTGAAGAAATATGA

Protein Analysis

68

Amino Acids

7.91

Weight (kDa)

4.18

Isoelectric Point (pI)

35.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 4 cut(s) 103, 122, 148, 197
AjnI CCWGG 1 cut(s) 30
AluBI AGCT 1 cut(s) 173
AluI AGCT 1 cut(s) 173
AsuHPI GGTGA 1 cut(s) 145
BbsI GAAGAC 1 cut(s) 110
BceAI ACGGC 1 cut(s) 94
BciT130I CCWGG 1 cut(s) 32
BclI TGATCA 1 cut(s) 187
BfaI CTAG 1 cut(s) 51
Bme1390I CCNGG 1 cut(s) 32
BmrFI CCNGG 1 cut(s) 32
BmsI GCATC 1 cut(s) 4
BpiI GAAGAC 1 cut(s) 110
BseBI CCWGG 1 cut(s) 32
Bsp143I GATC 1 cut(s) 187
BssMI GATC 1 cut(s) 187
Bst2UI CCWGG 1 cut(s) 32
Bst4CI ACNGT 1 cut(s) 137
BstKTI GATC 1 cut(s) 190
BstMBI GATC 1 cut(s) 187
BstNI CCWGG 1 cut(s) 32
BstSCI CCNGG 1 cut(s) 30
BstV2I GAAGAC 1 cut(s) 110
BtgZI GCGATG 1 cut(s) 27
BtsI GCAGTG 1 cut(s) 24
BtsIMutI CAGTG 2 cut(s) 24, 142
CseI GACGC 1 cut(s) 98
CviAII CATG 1 cut(s) 191
CviJI RGCY 1 cut(s) 173
CviKI_1 RGCY 1 cut(s) 173
DpnI GATC 1 cut(s) 189
DpnII GATC 1 cut(s) 187
DraI TTTAAA 1 cut(s) 45
EcoRII CCWGG 1 cut(s) 30
FaeI CATG 1 cut(s) 194
FaiI YATR 8 cut(s) 83, 96, 126, 128, 130, 132, 192, 205
FatI CATG 1 cut(s) 190
FbaI TGATCA 1 cut(s) 187
FspBI CTAG 1 cut(s) 51
HgaI GACGC 1 cut(s) 98
Hin1II CATG 1 cut(s) 194
HincII GTYRAC 1 cut(s) 88
HindII GTYRAC 1 cut(s) 88
HphI GGTGA 1 cut(s) 145
Hpy166II GTNNAC 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 88
HpyCH4III ACNGT 1 cut(s) 137
HpyCH4V TGCA 1 cut(s) 17
Hsp92II CATG 1 cut(s) 194
Ksp22I TGATCA 1 cut(s) 187
Kzo9I GATC 1 cut(s) 187
LpnPI CCDG 2 cut(s) 17, 44
LweI GCATC 1 cut(s) 4
MaeI CTAG 1 cut(s) 51
MaeIII GTNAC 1 cut(s) 68
MalI GATC 1 cut(s) 189
MboI GATC 1 cut(s) 187
MboII GAAGA 2 cut(s) 115, 152
MluCI AATT 2 cut(s) 40, 98
MnlI CCTC 2 cut(s) 55, 125
MseI TTAA 1 cut(s) 44
MslI CAYNNNNRTG 1 cut(s) 129
MspR9I CCNGG 1 cut(s) 32
MvaI CCWGG 1 cut(s) 32
NdeII GATC 1 cut(s) 187
NlaIII CATG 1 cut(s) 194
NmuCI GTSAC 1 cut(s) 68
Psp6I CCWGG 1 cut(s) 30
PspGI CCWGG 1 cut(s) 30
RseI CAYNNNNRTG 1 cut(s) 129
SaqAI TTAA 1 cut(s) 44
Sau3AI GATC 1 cut(s) 187
ScrFI CCNGG 1 cut(s) 32
SetI ASST 3 cut(s) 56, 117, 175
SfaNI GCATC 1 cut(s) 4
SgeI CNNG 4 cut(s) 43, 44, 63, 203
SmiI ATTTAAAT 1 cut(s) 45
SmiMI CAYNNNNRTG 1 cut(s) 129
Sse9I AATT 2 cut(s) 40, 98
SspMI CTAG 1 cut(s) 51
StyD4I CCNGG 1 cut(s) 30
SwaI ATTTAAAT 1 cut(s) 45
TaaI ACNGT 1 cut(s) 137
TasI AATT 2 cut(s) 40, 98
Tru1I TTAA 1 cut(s) 44
Tru9I TTAA 1 cut(s) 44
TscAI CASTG 2 cut(s) 24, 142
TseFI GTSAC 1 cut(s) 68
Tsp45I GTSAC 1 cut(s) 68
TspDTI ATGAA 2 cut(s) 111, 183
TspRI CASTG 2 cut(s) 24, 142
XspI CTAG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.