Rh7CG146600

dual specificity protein phosphatase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
11957469 .. 11958426
958 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG146600.1

Sequence Viewer

Length: 183 bp
ATGCTAAAGAGCGATGCAGTCAAATTTTTCCAGGAAAACAATTTTAATGCTAGGTTCTTTGAGGGTAGTGACAATAACGGCATAGTTGACGCTTATGAATTGAAGATTTCAACATCACCAACATCTTTGATGAAGCTGTTGAGTTTATTGATCATGTTGAAGAAACAGGAGGGAAGGTTCTAG

Protein Analysis

60

Amino Acids

6.88

Weight (kDa)

8.06

Isoelectric Point (pI)

8.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 23
AgsI TTSAA 3 cut(s) 103, 111, 160
AjnI CCWGG 1 cut(s) 30
AloI GAACNNNNNNTCC 1 cut(s) 161
AluBI AGCT 1 cut(s) 136
AluI AGCT 1 cut(s) 136
ApoI RAATTY 1 cut(s) 23
AsuHPI GGTGA 1 cut(s) 108
BceAI ACGGC 1 cut(s) 94
BciT130I CCWGG 1 cut(s) 32
BclI TGATCA 1 cut(s) 150
BfaI CTAG 2 cut(s) 51, 181
Bme1390I CCNGG 1 cut(s) 32
BmrFI CCNGG 1 cut(s) 32
BmsI GCATC 1 cut(s) 4
BsaXI ACNNNNNCTCC 1 cut(s) 161
BseBI CCWGG 1 cut(s) 32
Bsp143I GATC 1 cut(s) 150
BssMI GATC 1 cut(s) 150
Bst2UI CCWGG 1 cut(s) 32
BstKTI GATC 1 cut(s) 153
BstMBI GATC 1 cut(s) 150
BstNI CCWGG 1 cut(s) 32
BstSCI CCNGG 1 cut(s) 30
BtgZI GCGATG 1 cut(s) 27
CseI GACGC 1 cut(s) 98
CviAII CATG 1 cut(s) 154
CviJI RGCY 1 cut(s) 136
CviKI_1 RGCY 1 cut(s) 136
DpnI GATC 1 cut(s) 152
DpnII GATC 1 cut(s) 150
EcoRII CCWGG 1 cut(s) 30
FaeI CATG 1 cut(s) 157
FaiI YATR 3 cut(s) 83, 96, 155
FatI CATG 1 cut(s) 153
FbaI TGATCA 1 cut(s) 150
FspBI CTAG 2 cut(s) 51, 181
HgaI GACGC 1 cut(s) 98
Hin1II CATG 1 cut(s) 157
HincII GTYRAC 1 cut(s) 88
HindII GTYRAC 1 cut(s) 88
HphI GGTGA 1 cut(s) 108
Hpy166II GTNNAC 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 88
HpyAV CCTTC 1 cut(s) 168
HpyCH4V TGCA 1 cut(s) 17
Hsp92II CATG 1 cut(s) 157
Ksp22I TGATCA 1 cut(s) 150
Kzo9I GATC 1 cut(s) 150
LpnPI CCDG 3 cut(s) 17, 44, 152
LweI GCATC 1 cut(s) 4
MaeI CTAG 2 cut(s) 51, 181
MaeIII GTNAC 1 cut(s) 68
MalI GATC 1 cut(s) 152
MboI GATC 1 cut(s) 150
MboII GAAGA 2 cut(s) 115, 172
MluCI AATT 3 cut(s) 23, 40, 98
MnlI CCTC 2 cut(s) 55, 163
MseI TTAA 1 cut(s) 45
MspR9I CCNGG 1 cut(s) 32
MvaI CCWGG 1 cut(s) 32
NdeII GATC 1 cut(s) 150
NlaIII CATG 1 cut(s) 157
NmuCI GTSAC 1 cut(s) 68
PfoI TCCNGGA 1 cut(s) 30
Psp6I CCWGG 1 cut(s) 30
PspGI CCWGG 1 cut(s) 30
SaqAI TTAA 1 cut(s) 45
Sau3AI GATC 1 cut(s) 150
ScrFI CCNGG 1 cut(s) 32
SetI ASST 3 cut(s) 56, 138, 179
SfaNI GCATC 1 cut(s) 4
SgeI CNNG 5 cut(s) 43, 44, 63, 166, 179
Sse9I AATT 3 cut(s) 23, 40, 98
SspMI CTAG 2 cut(s) 51, 181
StyD4I CCNGG 1 cut(s) 30
TasI AATT 3 cut(s) 23, 40, 98
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
TseFI GTSAC 1 cut(s) 68
Tsp45I GTSAC 1 cut(s) 68
TspDTI ATGAA 2 cut(s) 111, 146
XapI RAATTY 1 cut(s) 23
XspI CTAG 2 cut(s) 51, 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.