Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8071116.1

Orthogroup ID

OG0003250

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 422

Gene Structure 421 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8071116.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 421 bp

atgttggaccttgtcatcagaaatgaagatagactaccttgccgtcagctcagatggcgtggaaactcggcaaatctattgtttgcagacaaaatggattttggaaatatggacagattggaggaagcctttgattctgccatcaagagatacaaaccaagagtgatcagagctcttcaaaaggatagaagggcaacttcagtagatatcagattgcataatacagcattggtaccacagaaatctgatctttctgacattatggattcgccaaggtctagtcagatgagcgtaaagagtcaactctcagatgatttaatgttttccgattttccagttgtggctattgattctggcgttcctcgtcgacctcctgctggaaaacgtgcaaatgaccaggaaatttatccaaagttggttg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000226 GO:0001101 GO:0003674 GO:0003824 GO:0004721 GO:0005488 GO:0005515 GO:0005516 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006464 GO:0006470 GO:0006793 GO:0006796 GO:0006807 GO:0006996 GO:0007010 GO:0007017 GO:0008138 GO:0008150 GO:0008152 GO:0009719 GO:0009725 GO:0009737 GO:0009987 GO:0010033 GO:0010119 GO:0010468 GO:0016043 GO:0016311 GO:0016787 GO:0016788 GO:0016791 GO:0019222 GO:0019538 GO:0030865 GO:0031122 GO:0033993 GO:0036211 GO:0042221 GO:0042578 GO:0043170 GO:0043412 GO:0043622 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044424 GO:0044464 GO:0050789 GO:0050794 GO:0050896 GO:0060255 GO:0065007 GO:0071704 GO:0071840 GO:0097305 GO:0097435 GO:0140096 GO:1901564 GO:1901700

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Act-Frag_cataly DSPc

Protein Analysis

140

Amino Acids

16.05

Weight (kDa)

9.45

Isoelectric Point (pI)

62.45

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003250)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G23720 AT5G23720 AT5G23720
fragaria_vesca	FvH4_5g09220 FvH4_5g09220 FvH4_5g09220 FvH4_5g09220 FvH4_5g09220 FvH4_5g09220 FvH4_5g09220 FvH4_5g09220 FvH4_5g09220
malus_domestica	MD06G1132400.v1.1 MD14G1148800.v1.1
prunus_persica	Prupe.5G143400_v2.0.a1
pyrus_communis	pycom06g12400 pycom14g12360
rosa_chinensis	RchiOBHm_Chr4g0416471 RchiOBHm_Chr7g0188941 RchiOBHm_Chr7g0194331
rosa_laevigata	RLG00000004049 RLG00000004648
rosa_multiflora	Rmu_co8071116.1_g000001 Rmu_sc0007831.1_g000001 Rmu_sc0032883.1_g000001 Rmu_ssc0000113.1_g000006
rosa_roxburghii	Rroxscaffold_3G00265920
rosa_rugosa	Rorug06G0494800 Rorug06G0494900 Rorug06G0495000
rosa_samantha	Rh7AG099700 Rh7BG101800 Rh7CG103100 Rh7CG146600 Rh7DG101600 Rh7DG144200
rosa_wichuraiana	Rw7G008590

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	232
AccB1I	GGYRCC	1 cut(s)	232
AccI	GTMKAC	1 cut(s)	367
AcsI	RAATTY	1 cut(s)	402
AcuI	CTGAAG	1 cut(s)	183
AfaI	GTAC	1 cut(s)	234
AfiI	CCNNNNNNNGG	1 cut(s)	377
AgsI	TTSAA	1 cut(s)	179
AjnI	CCWGG	1 cut(s)	396
AluBI	AGCT	2 cut(s)	49, 173
AluI	AGCT	2 cut(s)	49, 173
Alw21I	GWGCWC	1 cut(s)	175
ApoI	RAATTY	1 cut(s)	402
Asp718I	GGTACC	1 cut(s)	232
AspS9I	GGNCC	1 cut(s)	7
AvaII	GGWCC	1 cut(s)	7
BanI	GGYRCC	1 cut(s)	232
BanII	GRGCYC	1 cut(s)	175
BarI	GAAGNNNNNNTAC	2 cut(s)	18, 50
Bbv12I	GWGCWC	1 cut(s)	175
BccI	CCATC	2 cut(s)	48, 149
BceAI	ACGGC	1 cut(s)	27
BciT130I	CCWGG	1 cut(s)	398
BclI	TGATCA	1 cut(s)	165
BfaI	CTAG	1 cut(s)	279
Bme1390I	CCNGG	1 cut(s)	398
Bme18I	GGWCC	1 cut(s)	7
BmgT120I	GGNCC	1 cut(s)	7
BmiI	GGNNCC	1 cut(s)	234
BmrFI	CCNGG	1 cut(s)	398
BsaJI	CCNNGG	1 cut(s)	272
Bsc4I	CCNNNNNNNGG	1 cut(s)	377
Bse1I	ACTGG	1 cut(s)	335
BseBI	CCWGG	1 cut(s)	398
BseDI	CCNNGG	1 cut(s)	272
BseLI	CCNNNNNNNGG	1 cut(s)	377
BseMII	CTCAG	2 cut(s)	64, 321
BseNI	ACTGG	1 cut(s)	335
BshNI	GGYRCC	1 cut(s)	232
BsiHKAI	GWGCWC	1 cut(s)	175
BslI	CCNNNNNNNGG	1 cut(s)	377
Bsp1286I	GDGCHC	1 cut(s)	175
Bsp143I	GATC	2 cut(s)	165, 247
BspCNI	CTCAG	2 cut(s)	63, 320
BspLI	GGNNCC	1 cut(s)	234
BspQI	GCTCTTC	1 cut(s)	180
BspT107I	GGYRCC	1 cut(s)	232
BsrI	ACTGG	1 cut(s)	335
BssECI	CCNNGG	1 cut(s)	272
BssMI	GATC	2 cut(s)	165, 247
BssT1I	CCWWGG	1 cut(s)	272
Bst2UI	CCWGG	1 cut(s)	398
Bst6I	CTCTTC	1 cut(s)	180
BstDEI	CTNAG	2 cut(s)	50, 307
BstKTI	GATC	2 cut(s)	168, 250
BstMBI	GATC	2 cut(s)	165, 247
BstMWI	GCNNNNNNNGC	1 cut(s)	55
BstNI	CCWGG	1 cut(s)	398
BstSCI	CCNGG	1 cut(s)	396
Cfr13I	GGNCC	1 cut(s)	7
Csp6I	GTAC	1 cut(s)	233
CviJI	RGCY	4 cut(s)	49, 128, 173, 344
CviKI_1	RGCY	4 cut(s)	49, 128, 173, 344
CviQI	GTAC	1 cut(s)	233
DdeI	CTNAG	2 cut(s)	50, 307
DpnI	GATC	2 cut(s)	167, 249
DpnII	GATC	2 cut(s)	165, 247
Eam1104I	CTCTTC	1 cut(s)	180
EarI	CTCTTC	1 cut(s)	180
Ecl136II	GAGCTC	1 cut(s)	173
Eco130I	CCWWGG	1 cut(s)	272
Eco24I	GRGCYC	1 cut(s)	175
Eco32I	GATATC	1 cut(s)	208
Eco47I	GGWCC	1 cut(s)	7
Eco53kI	GAGCTC	1 cut(s)	173
Eco57I	CTGAAG	1 cut(s)	183
EcoICRI	GAGCTC	1 cut(s)	173
EcoRII	CCWGG	1 cut(s)	396
EcoRV	GATATC	1 cut(s)	208
EcoT14I	CCWWGG	1 cut(s)	272
EcoT38I	GRGCYC	1 cut(s)	175
ErhI	CCWWGG	1 cut(s)	272
FaiI	YATR	3 cut(s)	110, 219, 263
FalI	AAGNNNNNCTT	2 cut(s)	181, 213
FbaI	TGATCA	1 cut(s)	165
FblI	GTMKAC	1 cut(s)	367
FriOI	GRGCYC	1 cut(s)	175
FspBI	CTAG	1 cut(s)	279
HincII	GTYRAC	2 cut(s)	302, 368
HindII	GTYRAC	2 cut(s)	302, 368
HinfI	GANTC	4 cut(s)	134, 266, 298, 350
Hpy166II	GTNNAC	2 cut(s)	302, 368
Hpy188I	TCNGA	9 cut(s)	20, 53, 170, 212, 247, 256, 285, 310, 328
Hpy188III	TCNNGA	1 cut(s)	145
Hpy8I	GTNNAC	2 cut(s)	302, 368
Hpy99I	CGWCG	1 cut(s)	369
HpyAV	CCTTC	1 cut(s)	183
HpyCH4IV	ACGT	1 cut(s)	385
HpyCH4V	TGCA	3 cut(s)	86, 217, 389
HpyF10VI	GCNNNNNNNGC	1 cut(s)	55
HpyF3I	CTNAG	2 cut(s)	50, 307
HpySE526I	ACGT	1 cut(s)	385
KpnI	GGTACC	1 cut(s)	236
Ksp22I	TGATCA	1 cut(s)	165
Kzo9I	GATC	2 cut(s)	165, 247
LguI	GCTCTTC	1 cut(s)	180
LpnPI	CCDG	6 cut(s)	339, 348, 363, 383, 387, 410
MaeI	CTAG	1 cut(s)	279
MaeII	ACGT	1 cut(s)	385
MalI	GATC	2 cut(s)	167, 249
MboI	GATC	2 cut(s)	165, 247
MboII	GAAGA	2 cut(s)	38, 167
MhlI	GDGCHC	1 cut(s)	175
MluCI	AATT	1 cut(s)	402
MlyI	GAGTC	1 cut(s)	307
MnlI	CCTC	3 cut(s)	115, 372, 381
MseI	TTAA	1 cut(s)	317
MspR9I	CCNGG	1 cut(s)	398
MvaI	CCWGG	1 cut(s)	398
MwoI	GCNNNNNNNGC	1 cut(s)	55
NdeII	GATC	2 cut(s)	165, 247
NlaIV	GGNNCC	1 cut(s)	234
NmeAIII	GCCGAG	1 cut(s)	47
PciSI	GCTCTTC	1 cut(s)	180
PfeI	GAWTC	3 cut(s)	134, 266, 350
PflFI	GACNNNGTC	1 cut(s)	11
PleI	GAGTC	1 cut(s)	306
PpsI	GAGTC	1 cut(s)	306
Psp124BI	GAGCTC	1 cut(s)	175
Psp6I	CCWGG	1 cut(s)	396
PspGI	CCWGG	1 cut(s)	396
PspN4I	GGNNCC	1 cut(s)	234
PspPI	GGNCC	1 cut(s)	7
PsyI	GACNNNGTC	1 cut(s)	11
RsaI	GTAC	1 cut(s)	234
RsaNI	GTAC	1 cut(s)	233
SacI	GAGCTC	1 cut(s)	175
SalI	GTCGAC	1 cut(s)	366
SapI	GCTCTTC	1 cut(s)	180
SaqAI	TTAA	1 cut(s)	317
Sau3AI	GATC	2 cut(s)	165, 247
Sau96I	GGNCC	1 cut(s)	7
SchI	GAGTC	1 cut(s)	307
ScrFI	CCNGG	1 cut(s)	398
SduI	GDGCHC	1 cut(s)	175
SetI	ASST	7 cut(s)	12, 40, 51, 175, 278, 373, 388
SinI	GGWCC	1 cut(s)	7
Sse9I	AATT	1 cut(s)	402
SspMI	CTAG	1 cut(s)	279
SstI	GAGCTC	1 cut(s)	175
StyD4I	CCNGG	1 cut(s)	396
StyI	CCWWGG	1 cut(s)	272
TaiI	ACGT	1 cut(s)	388
TaqI	TCGA	1 cut(s)	367
TasI	AATT	1 cut(s)	402
TfiI	GAWTC	3 cut(s)	134, 266, 350
Tru1I	TTAA	1 cut(s)	317
Tru9I	TTAA	1 cut(s)	317
TspDTI	ATGAA	1 cut(s)	39
Tth111I	GACNNNGTC	1 cut(s)	11
VpaK11BI	GGWCC	1 cut(s)	7
XapI	RAATTY	1 cut(s)	402
XmiI	GTMKAC	1 cut(s)	367
XspI	CTAG	1 cut(s)	279

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.