Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr6

Orthogroup ID

OG0005554

Physical Location & Seq

Genomic Coordinates Forward (+)

4156300 .. 4157142

Gene Structure 843 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000026599

Sequence Viewer

CDS Protein Promoter (2k)

Length: 330 bp

ATGAAGTGTTTTCTGGCTCAGCATGGCGTAGAGAAAGAGCATCTTGTCCTTCTTGATGCAAGGGCTTCTAGGACCAAAAATCAGGGTGCTATAGATGCTGACATAGCAGGAACACTTGCTGATCCAAAAGGAGGAGCTGGTCTCTCCATTTCCTTCCCTCCATCCCCGTGGACAACAGGTCCTGCTCTGACCTGCGTCAATTCTGATGGGAAGTGGCTTCGAGCTAGCAAAGGTGCCAGTGAGCAGACAATATTAACCCTATGCACTGCATTGCTAGGCCAAGAAAAGGATGCATCCATTTCTGCCCTCCCCTTTGACGAATTGATTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

ko00190 map00190

Pfam Domains

Protein Families

Cation_ATPase_N E1-E2_ATPase Hydrolase

Protein Analysis

110

Amino Acids

11.41

Weight (kDa)

5.56

Isoelectric Point (pI)

29.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005554)

Species	Orthologous Gene IDs
pyrus_communis	pycom09g08340
rosa_chinensis	RchiOBHm_Chr2g0142631 RchiOBHm_Chr5g0038641 RchiOBHm_Chr5g0070991
rosa_laevigata	RLG00000026599 RLG00000030416
rosa_multiflora	Rmu_co8081158.1_g000001 Rmu_co8186984.1_g000001 Rmu_sc0005722.1_g000001 Rmu_sc0006417.1_g000011 Rmu_sc0012237.1_g000003 Rmu_sc0038346.1_g000002
rosa_roxburghii	Rroxscaffold_1G00036020 Rroxscaffold_1G00042390 Rroxscaffold_1G00042420 Rroxscaffold_1G00045550 Rroxscaffold_4G00307220 Rroxscaffold_4G00307700 Rroxscaffold_6G00398580 Rroxscaffold_7G00189540 Rroxscaffold_7G00189570
rosa_rugosa	Rorug05G0172400
rosa_samantha	Rh1CG020900 Rh4DG271200 Rh5CG296300 Rh5CG297300 Rh5CG297400 Rh5DG128000 Rh5DG292000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	200
AccB1I	GGYRCC	1 cut(s)	233
AclWI	GGATC	1 cut(s)	116
AfiI	CCNNNNNNNGG	2 cut(s)	131, 286
AhdI	GACNNNNNGTC	1 cut(s)	177
AluBI	AGCT	2 cut(s)	137, 224
AluI	AGCT	2 cut(s)	137, 224
Alw26I	GTCTC	1 cut(s)	146
AlwI	GGATC	1 cut(s)	116
AlwNI	CAGNNNCTG	1 cut(s)	182
AoxI	GGCC	1 cut(s)	277
AspS9I	GGNCC	2 cut(s)	72, 179
AsuNHI	GCTAGC	1 cut(s)	224
AvaII	GGWCC	2 cut(s)	72, 179
BanI	GGYRCC	1 cut(s)	233
BccI	CCATC	2 cut(s)	169, 200
BcoDI	GTCTC	1 cut(s)	146
BfaI	CTAG	3 cut(s)	69, 225, 275
BfmI	CTRYAG	1 cut(s)	90
BfuAI	ACCTGC	1 cut(s)	200
BlpI	GCTNAGC	1 cut(s)	18
Bme18I	GGWCC	2 cut(s)	72, 179
BmeRI	GACNNNNNGTC	1 cut(s)	177
BmgT120I	GGNCC	2 cut(s)	72, 179
BmiI	GGNNCC	1 cut(s)	235
BmsI	GCATC	5 cut(s)	46, 49, 85, 280, 302
BmtI	GCTAGC	1 cut(s)	228
BoxI	GACNNNNGTC	1 cut(s)	194
BplI	GAGNNNNNCTC	2 cut(s)	126, 158
Bpu1102I	GCTNAGC	1 cut(s)	18
BsaI	GGTCTC	1 cut(s)	146
BsaJI	CCNNGG	1 cut(s)	167
Bsc4I	CCNNNNNNNGG	2 cut(s)	131, 286
Bse1I	ACTGG	1 cut(s)	237
Bse3DI	GCAATG	1 cut(s)	269
BseDI	CCNNGG	1 cut(s)	167
BseGI	GGATG	3 cut(s)	161, 293, 295
BseLI	CCNNNNNNNGG	2 cut(s)	131, 286
BseMI	GCAATG	1 cut(s)	269
BseMII	CTCAG	1 cut(s)	32
BseNI	ACTGG	1 cut(s)	237
BseRI	GAGGAG	1 cut(s)	147
BshFI	GGCC	1 cut(s)	279
BshNI	GGYRCC	1 cut(s)	233
BslI	CCNNNNNNNGG	2 cut(s)	131, 286
BsmAI	GTCTC	1 cut(s)	146
BsnI	GGCC	1 cut(s)	279
Bso31I	GGTCTC	1 cut(s)	146
Bsp143I	GATC	1 cut(s)	121
Bsp1720I	GCTNAGC	1 cut(s)	18
BspANI	GGCC	1 cut(s)	279
BspCNI	CTCAG	1 cut(s)	31
BspLI	GGNNCC	1 cut(s)	235
BspMI	ACCTGC	1 cut(s)	200
BspOI	GCTAGC	1 cut(s)	228
BspPI	GGATC	1 cut(s)	116
BspT107I	GGYRCC	1 cut(s)	233
BspTNI	GGTCTC	1 cut(s)	146
BsrDI	GCAATG	1 cut(s)	269
BsrI	ACTGG	1 cut(s)	237
BssECI	CCNNGG	1 cut(s)	167
BssMI	GATC	1 cut(s)	121
BstC8I	GCNNGC	1 cut(s)	226
BstDEI	CTNAG	1 cut(s)	18
BstDSI	CCRYGG	1 cut(s)	167
BstF5I	GGATG	3 cut(s)	161, 293, 295
BstKTI	GATC	1 cut(s)	124
BstMAI	GTCTC	1 cut(s)	146
BstMBI	GATC	1 cut(s)	121
BstMWI	GCNNNNNNNGC	2 cut(s)	95, 104
BstPAI	GACNNNNGTC	1 cut(s)	194
BstSFI	CTRYAG	1 cut(s)	90
BstXI	CCANNNNNNTGG	1 cut(s)	168
BsuRI	GGCC	1 cut(s)	279
BtgI	CCRYGG	1 cut(s)	167
BtsCI	GGATG	3 cut(s)	161, 293, 295
BtsI	GCAGTG	1 cut(s)	264
BtsIMutI	CAGTG	2 cut(s)	244, 264
BveI	ACCTGC	1 cut(s)	200
Cac8I	GCNNGC	1 cut(s)	226
CaiI	CAGNNNCTG	1 cut(s)	182
Cfr13I	GGNCC	2 cut(s)	72, 179
CseI	GACGC	1 cut(s)	184
CviAII	CATG	1 cut(s)	23
CviJI	RGCY	6 cut(s)	17, 65, 137, 217, 224, 279
CviKI_1	RGCY	6 cut(s)	17, 65, 137, 217, 224, 279
DdeI	CTNAG	1 cut(s)	18
DpnI	GATC	1 cut(s)	123
DpnII	GATC	1 cut(s)	121
DriI	GACNNNNNGTC	1 cut(s)	177
Eam1105I	GACNNNNNGTC	1 cut(s)	177
Eco31I	GGTCTC	1 cut(s)	146
Eco47I	GGWCC	2 cut(s)	72, 179
EcoO109I	RGGNCCY	1 cut(s)	179
EcoT22I	ATGCAT	1 cut(s)	295
FaeI	CATG	1 cut(s)	26
FaiI	YATR	4 cut(s)	24, 92, 104, 262
FalI	AAGNNNNNCTT	2 cut(s)	27, 59
FatI	CATG	1 cut(s)	22
FokI	GGATG	3 cut(s)	148, 280, 302
FspBI	CTAG	3 cut(s)	69, 225, 275
HaeIII	GGCC	1 cut(s)	279
HgaI	GACGC	1 cut(s)	184
Hin1II	CATG	1 cut(s)	26
Hpy166II	GTNNAC	1 cut(s)	171
Hpy188I	TCNGA	2 cut(s)	189, 205
Hpy188III	TCNNGA	1 cut(s)	53
Hpy8I	GTNNAC	1 cut(s)	171
HpyAV	CCTTC	2 cut(s)	59, 163
HpyCH4V	TGCA	4 cut(s)	59, 264, 269, 293
HpyF10VI	GCNNNNNNNGC	2 cut(s)	95, 104
HpyF3I	CTNAG	1 cut(s)	18
Hsp92II	CATG	1 cut(s)	26
Kzo9I	GATC	1 cut(s)	121
LmnI	GCTCC	1 cut(s)	134
LpnPI	CCDG	7 cut(s)	68, 93, 123, 162, 195, 205, 250
LweI	GCATC	5 cut(s)	46, 49, 85, 280, 302
MaeI	CTAG	3 cut(s)	69, 225, 275
MalI	GATC	1 cut(s)	123
MboI	GATC	1 cut(s)	121
MluCI	AATT	2 cut(s)	199, 320
MnlI	CCTC	3 cut(s)	125, 168, 317
Mph1103I	ATGCAT	1 cut(s)	295
MseI	TTAA	1 cut(s)	254
MslI	CAYNNNNRTG	1 cut(s)	166
MwoI	GCNNNNNNNGC	2 cut(s)	95, 104
NdeII	GATC	1 cut(s)	121
NheI	GCTAGC	1 cut(s)	224
NlaIII	CATG	1 cut(s)	26
NlaIV	GGNNCC	1 cut(s)	235
NsiI	ATGCAT	1 cut(s)	295
PpuMI	RGGWCCY	1 cut(s)	179
PshAI	GACNNNNGTC	1 cut(s)	194
Psp5II	RGGWCCY	1 cut(s)	179
PspN4I	GGNNCC	1 cut(s)	235
PspPI	GGNCC	2 cut(s)	72, 179
PspPPI	RGGWCCY	1 cut(s)	179
PstNI	CAGNNNCTG	1 cut(s)	182
RseI	CAYNNNNRTG	1 cut(s)	166
SaqAI	TTAA	1 cut(s)	254
Sau3AI	GATC	1 cut(s)	121
Sau96I	GGNCC	2 cut(s)	72, 179
SetI	ASST	5 cut(s)	139, 181, 194, 226, 235
SfaNI	GCATC	5 cut(s)	46, 49, 85, 280, 302
SfcI	CTRYAG	1 cut(s)	90
SinI	GGWCC	2 cut(s)	72, 179
SmiMI	CAYNNNNRTG	1 cut(s)	166
Sse9I	AATT	2 cut(s)	199, 320
SspI	AATATT	1 cut(s)	252
SspMI	CTAG	3 cut(s)	69, 225, 275
TaqI	TCGA	1 cut(s)	220
TasI	AATT	2 cut(s)	199, 320
Tru1I	TTAA	1 cut(s)	254
Tru9I	TTAA	1 cut(s)	254
TscAI	CASTG	2 cut(s)	244, 271
TspDTI	ATGAA	1 cut(s)	17
TspRI	CASTG	2 cut(s)	244, 271
VpaK11BI	GGWCC	2 cut(s)	72, 179
XspI	CTAG	3 cut(s)	69, 225, 275
Zsp2I	ATGCAT	1 cut(s)	295

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.