Rh5CG297300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
32720292 .. 32720603
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG297300.1

Sequence Viewer

Length: 312 bp
ATGACATCAGAAATATTTGAGAATGACATTACATTGGGTAAAGTTGTGACTTGGGGTGGTAAGGGTAAGAGGAAGCTGAGAAAGGTAAGCATCATTATTGGCAATGAATGTCCTAGTAGCACCTCTCCAGAGGAACAGGAATGCGCTAGCCTCAGCTCTTCATTTGAGAGACCGGAATACGCTTGCAGCAGGTCTGTAGTTGAGAAACCAGAATATGCTAGCAGCAGTTCATTTGAAAAACGGGTGTCACAACTTAAATCTAAGGTTACAATGCTTGAAAAGATAGTTGAGGTGTTAAAATCTAGGATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

11.49

Weight (kDa)

8.82

Isoelectric Point (pI)

67.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 180
AgsI TTSAA 2 cut(s) 236, 278
AluBI AGCT 2 cut(s) 76, 156
AluI AGCT 2 cut(s) 76, 156
Alw26I GTCTC 1 cut(s) 163
ApeKI GCWGC 2 cut(s) 186, 222
AspLEI GCGC 1 cut(s) 146
AsuNHI GCTAGC 2 cut(s) 146, 218
BbvCI CCTCAGC 1 cut(s) 152
BbvI GCAGC 2 cut(s) 198, 234
BcoDI GTCTC 1 cut(s) 163
BfaI CTAG 4 cut(s) 114, 147, 219, 303
BfmI CTRYAG 1 cut(s) 195
BfuAI ACCTGC 1 cut(s) 180
BisI GCNGC 2 cut(s) 187, 223
BlsI GCNGC 2 cut(s) 188, 224
BmsI GCATC 1 cut(s) 99
BmtI GCTAGC 2 cut(s) 150, 222
BpmI CTGGAG 1 cut(s) 111
Bpu10I CCTNAGC 1 cut(s) 152
BsaI GGTCTC 1 cut(s) 163
BsaWI WCCGGW 1 cut(s) 172
Bse3DI GCAATG 1 cut(s) 109
BseMI GCAATG 1 cut(s) 109
BseMII CTCAG 2 cut(s) 68, 166
BseXI GCAGC 2 cut(s) 198, 234
BsiSI CCGG 1 cut(s) 173
BsmAI GTCTC 1 cut(s) 163
BsmI GAATGC 1 cut(s) 146
Bso31I GGTCTC 1 cut(s) 163
BspCNI CTCAG 2 cut(s) 69, 165
BspMI ACCTGC 1 cut(s) 180
BspOI GCTAGC 2 cut(s) 150, 222
BspQI GCTCTTC 1 cut(s) 163
BspTNI GGTCTC 1 cut(s) 163
BsrDI GCAATG 1 cut(s) 109
Bst6I CTCTTC 1 cut(s) 163
BstC8I GCNNGC 3 cut(s) 148, 184, 220
BstDEI CTNAG 3 cut(s) 77, 152, 261
BstHHI GCGC 1 cut(s) 146
BstMAI GTCTC 1 cut(s) 163
BstSFI CTRYAG 1 cut(s) 195
BstV1I GCAGC 2 cut(s) 198, 234
BveI ACCTGC 1 cut(s) 180
Cac8I GCNNGC 3 cut(s) 148, 184, 220
CfoI GCGC 1 cut(s) 146
CviJI RGCY 3 cut(s) 76, 150, 156
CviKI_1 RGCY 3 cut(s) 76, 150, 156
DdeI CTNAG 3 cut(s) 77, 152, 261
Eam1104I CTCTTC 1 cut(s) 163
EarI CTCTTC 1 cut(s) 163
Eco31I GGTCTC 1 cut(s) 163
FaiI YATR 2 cut(s) 216, 310
Fnu4HI GCNGC 2 cut(s) 187, 223
Fsp4HI GCNGC 2 cut(s) 187, 223
FspBI CTAG 4 cut(s) 114, 147, 219, 303
GlaI GCGC 1 cut(s) 145
GluI GCNGC 2 cut(s) 187, 223
GsuI CTGGAG 1 cut(s) 111
HapII CCGG 1 cut(s) 173
HhaI GCGC 1 cut(s) 146
Hin6I GCGC 1 cut(s) 144
HinP1I GCGC 1 cut(s) 144
HpaII CCGG 1 cut(s) 173
Hpy188I TCNGA 1 cut(s) 10
Hpy188III TCNNGA 1 cut(s) 128
HpyCH4V TGCA 1 cut(s) 186
HpyF3I CTNAG 3 cut(s) 77, 152, 261
HspAI GCGC 1 cut(s) 144
LguI GCTCTTC 1 cut(s) 163
LpnPI CCDG 5 cut(s) 122, 141, 175, 186, 222
Lsp1109I GCAGC 2 cut(s) 198, 234
LweI GCATC 1 cut(s) 99
MaeI CTAG 4 cut(s) 114, 147, 219, 303
MaeIII GTNAC 3 cut(s) 46, 246, 265
MboII GAAGA 1 cut(s) 150
MnlI CCTC 5 cut(s) 63, 124, 133, 161, 283
MseI TTAA 2 cut(s) 255, 296
MspI CCGG 1 cut(s) 173
Mva1269I GAATGC 1 cut(s) 146
NheI GCTAGC 2 cut(s) 146, 218
NmuCI GTSAC 2 cut(s) 46, 246
PciSI GCTCTTC 1 cut(s) 163
PctI GAATGC 1 cut(s) 146
PkrI GCNGC 2 cut(s) 188, 224
SapI GCTCTTC 1 cut(s) 163
SaqAI TTAA 2 cut(s) 255, 296
SatI GCNGC 2 cut(s) 187, 223
SetI ASST 7 cut(s) 78, 87, 125, 158, 194, 267, 294
SfaNI GCATC 1 cut(s) 99
SfcI CTRYAG 1 cut(s) 195
SspI AATATT 1 cut(s) 15
SspMI CTAG 4 cut(s) 114, 147, 219, 303
Tru1I TTAA 2 cut(s) 255, 296
Tru9I TTAA 2 cut(s) 255, 296
TseFI GTSAC 2 cut(s) 46, 246
TseI GCWGC 2 cut(s) 186, 222
Tsp45I GTSAC 2 cut(s) 46, 246
TspDTI ATGAA 3 cut(s) 120, 150, 219
XspI CTAG 4 cut(s) 114, 147, 219, 303
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.