Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5C

Orthogroup ID

OG0005554

Physical Location & Seq

Genomic Coordinates Reverse (-)

32623534 .. 32624197

Gene Structure 664 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5CG296300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 567 bp

ATGAATTATGACAATGAGAAATTGTATATTCCATCCAGGATTTCTGATGCAGATGTTAGCATTAGATACTTGAATTGGTGGAAGGAATCAGTGTCAGGCCTCGAGCAGGGACATATGCCACCCAAAAAGAAAGTTAAGAAAGCTGTAGACTTGATATATGATGCCACCATTCCTTTTATTTGTTCTCCAAAGAATTCAGAAGAATTTGTGCATGTTTCAGCAGGAAGGAATGAGGGTGAATATTCCCTTGGTCCTCCAGGATTTCCTCTCAAAAGGAATAGAATGGAAGCTGGAGATCCTATGGACGAAGATGAACTAACTATATCAGAAACTTTGAAACTTGGGAAGAAGCTTAAAACTGTTGAAACTAGAAAAAGTACCGACAGTGCGAAGGTATCAAGTCCCGATCAAATCTTTGCATCTTCATCTGCAGATGAAAGTTCTATGAATATTATGAAGTCAAAAATACTGGAGAAAGAAGTTGTGTTGAGTAGTGAAGTGGTGACTTGGAGAAGTAAAAGTCAGAGGAAACTGGACAAGGTAATCATGACATGTGTCATCATTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PMD

Protein Analysis

188

Amino Acids

21.18

Weight (kDa)

7.69

Isoelectric Point (pI)

38.45

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005554)

Species	Orthologous Gene IDs
pyrus_communis	pycom09g08340
rosa_chinensis	RchiOBHm_Chr2g0142631 RchiOBHm_Chr5g0038641 RchiOBHm_Chr5g0070991
rosa_laevigata	RLG00000026599 RLG00000030416
rosa_multiflora	Rmu_co8081158.1_g000001 Rmu_co8186984.1_g000001 Rmu_sc0005722.1_g000001 Rmu_sc0006417.1_g000011 Rmu_sc0012237.1_g000003 Rmu_sc0038346.1_g000002
rosa_roxburghii	Rroxscaffold_1G00036020 Rroxscaffold_1G00042390 Rroxscaffold_1G00042420 Rroxscaffold_1G00045550 Rroxscaffold_4G00307220 Rroxscaffold_4G00307700 Rroxscaffold_6G00398580 Rroxscaffold_7G00189540 Rroxscaffold_7G00189570
rosa_rugosa	Rorug05G0172400
rosa_samantha	Rh1CG020900 Rh4DG271200 Rh5CG296300 Rh5CG297300 Rh5CG297400 Rh5DG128000 Rh5DG292000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	147
AclWI	GGATC	1 cut(s)	290
AcsI	RAATTY	2 cut(s)	193, 203
AfaI	GTAC	1 cut(s)	379
AfiI	CCNNNNNNNGG	1 cut(s)	106
AflIII	ACRYGT	1 cut(s)	551
AgsI	TTSAA	3 cut(s)	73, 337, 365
AjnI	CCWGG	2 cut(s)	35, 256
AjuI	GAANNNNNNNTTGG	2 cut(s)	231, 263
AluBI	AGCT	3 cut(s)	143, 290, 352
AluI	AGCT	3 cut(s)	143, 290, 352
AlwI	GGATC	1 cut(s)	290
Ama87I	CYCGRG	1 cut(s)	101
AoxI	GGCC	1 cut(s)	97
ApoI	RAATTY	2 cut(s)	193, 203
AspS9I	GGNCC	1 cut(s)	251
AsuHPI	GGTGA	2 cut(s)	248, 514
AvaI	CYCGRG	1 cut(s)	101
AvaII	GGWCC	1 cut(s)	251
BccI	CCATC	1 cut(s)	40
BciT130I	CCWGG	2 cut(s)	37, 258
BfaI	CTAG	1 cut(s)	369
BfmI	CTRYAG	2 cut(s)	144, 429
Bme1390I	CCNGG	2 cut(s)	37, 258
Bme18I	GGWCC	1 cut(s)	251
BmeT110I	CYCGRG	1 cut(s)	101
BmgT120I	GGNCC	1 cut(s)	251
BmrFI	CCNGG	2 cut(s)	37, 258
BmsI	GCATC	3 cut(s)	37, 151, 428
BoxI	GACNNNNGTC	1 cut(s)	554
BpmI	CTGGAG	3 cut(s)	240, 312, 491
BsaJI	CCNNGG	1 cut(s)	247
Bsc4I	CCNNNNNNNGG	1 cut(s)	106
Bse1I	ACTGG	2 cut(s)	474, 537
BseBI	CCWGG	2 cut(s)	37, 258
BseDI	CCNNGG	1 cut(s)	247
BseGI	GGATG	1 cut(s)	32
BseLI	CCNNNNNNNGG	1 cut(s)	106
BseNI	ACTGG	2 cut(s)	474, 537
BshFI	GGCC	1 cut(s)	99
BsiHKCI	CYCGRG	1 cut(s)	101
BslFI	GGGAC	2 cut(s)	123, 387
BslI	CCNNNNNNNGG	1 cut(s)	106
BsmFI	GGGAC	2 cut(s)	123, 387
BsnI	GGCC	1 cut(s)	99
BsoBI	CYCGRG	1 cut(s)	101
Bsp143I	GATC	2 cut(s)	295, 406
BspANI	GGCC	1 cut(s)	99
BspHI	TCATGA	1 cut(s)	546
BspMAI	CTGCAG	1 cut(s)	433
BspPI	GGATC	1 cut(s)	290
BsrI	ACTGG	2 cut(s)	474, 537
BssECI	CCNNGG	1 cut(s)	247
BssMI	GATC	2 cut(s)	295, 406
BssT1I	CCWWGG	1 cut(s)	247
Bst2UI	CCWGG	2 cut(s)	37, 258
Bst4CI	ACNGT	2 cut(s)	361, 386
BstENI	CCTNNNNNAGG	1 cut(s)	104
BstF5I	GGATG	1 cut(s)	32
BstKTI	GATC	2 cut(s)	298, 409
BstMBI	GATC	2 cut(s)	295, 406
BstNI	CCWGG	2 cut(s)	37, 258
BstNSI	RCATGY	2 cut(s)	215, 555
BstPAI	GACNNNNGTC	1 cut(s)	554
BstSCI	CCNGG	2 cut(s)	35, 256
BstSFI	CTRYAG	2 cut(s)	144, 429
BstX2I	RGATCY	1 cut(s)	295
BstYI	RGATCY	1 cut(s)	295
BsuRI	GGCC	1 cut(s)	99
BtsCI	GGATG	1 cut(s)	32
BtsIMutI	CAGTG	2 cut(s)	96, 391
CciI	TCATGA	1 cut(s)	546
Cfr13I	GGNCC	1 cut(s)	251
Csp6I	GTAC	1 cut(s)	378
CviAII	CATG	3 cut(s)	212, 547, 552
CviJI	RGCY	4 cut(s)	99, 143, 290, 352
CviKI_1	RGCY	4 cut(s)	99, 143, 290, 352
CviQI	GTAC	1 cut(s)	378
DpnI	GATC	2 cut(s)	297, 408
DpnII	GATC	2 cut(s)	295, 406
Eco130I	CCWWGG	1 cut(s)	247
Eco147I	AGGCCT	1 cut(s)	99
Eco47I	GGWCC	1 cut(s)	251
Eco88I	CYCGRG	1 cut(s)	101
EcoNI	CCTNNNNNAGG	1 cut(s)	104
EcoRI	GAATTC	1 cut(s)	193
EcoRII	CCWGG	2 cut(s)	35, 256
EcoT14I	CCWWGG	1 cut(s)	247
ErhI	CCWWGG	1 cut(s)	247
FaeI	CATG	3 cut(s)	215, 550, 555
FaqI	GGGAC	2 cut(s)	123, 387
FatI	CATG	3 cut(s)	211, 546, 551
FauNDI	CATATG	1 cut(s)	114
FblI	GTMKAC	1 cut(s)	147
FokI	GGATG	1 cut(s)	19
FspBI	CTAG	1 cut(s)	369
GsuI	CTGGAG	3 cut(s)	240, 312, 491
HaeIII	GGCC	1 cut(s)	99
Hin1II	CATG	3 cut(s)	215, 550, 555
HindIII	AAGCTT	1 cut(s)	350
HinfI	GANTC	1 cut(s)	86
HphI	GGTGA	2 cut(s)	248, 514
Hpy166II	GTNNAC	1 cut(s)	148
Hpy188I	TCNGA	4 cut(s)	46, 199, 328, 525
Hpy188III	TCNNGA	2 cut(s)	404, 547
Hpy8I	GTNNAC	1 cut(s)	148
HpyAV	CCTTC	3 cut(s)	76, 219, 385
HpyCH4III	ACNGT	2 cut(s)	361, 386
HpyCH4V	TGCA	4 cut(s)	50, 211, 419, 431
Hsp92II	CATG	3 cut(s)	215, 550, 555
Kzo9I	GATC	2 cut(s)	295, 406
LweI	GCATC	3 cut(s)	37, 151, 428
MaeI	CTAG	1 cut(s)	369
MaeIII	GTNAC	1 cut(s)	502
MalI	GATC	2 cut(s)	297, 408
MboI	GATC	2 cut(s)	295, 406
MboII	GAAGA	4 cut(s)	212, 320, 358, 414
MflI	RGATCY	1 cut(s)	295
MluCI	AATT	5 cut(s)	4, 20, 73, 193, 203
MnlI	CCTC	5 cut(s)	110, 226, 264, 276, 519
MseI	TTAA	3 cut(s)	135, 354, 565
MspR9I	CCNGG	2 cut(s)	37, 258
MvaI	CCWGG	2 cut(s)	37, 258
NdeI	CATATG	1 cut(s)	114
NdeII	GATC	2 cut(s)	295, 406
NlaIII	CATG	3 cut(s)	215, 550, 555
NmuCI	GTSAC	1 cut(s)	502
NspI	RCATGY	2 cut(s)	215, 555
PaeR7I	CTCGAG	1 cut(s)	101
PagI	TCATGA	1 cut(s)	546
PceI	AGGCCT	1 cut(s)	99
PciI	ACATGT	1 cut(s)	551
PfeI	GAWTC	1 cut(s)	86
PfoI	TCCNGGA	2 cut(s)	35, 256
PscI	ACATGT	1 cut(s)	551
PshAI	GACNNNNGTC	1 cut(s)	554
Psp6I	CCWGG	2 cut(s)	35, 256
PspGI	CCWGG	2 cut(s)	35, 256
PspPI	GGNCC	1 cut(s)	251
PspXI	VCTCGAGB	1 cut(s)	101
PstI	CTGCAG	1 cut(s)	433
PsuI	RGATCY	1 cut(s)	295
RsaI	GTAC	1 cut(s)	379
RsaNI	GTAC	1 cut(s)	378
SaqAI	TTAA	3 cut(s)	135, 354, 565
Sau3AI	GATC	2 cut(s)	295, 406
Sau96I	GGNCC	1 cut(s)	251
ScrFI	CCNGG	2 cut(s)	37, 258
SetI	ASST	5 cut(s)	145, 292, 354, 396, 543
SfaNI	GCATC	3 cut(s)	37, 151, 428
SfcI	CTRYAG	2 cut(s)	144, 429
Sfr274I	CTCGAG	1 cut(s)	101
SinI	GGWCC	1 cut(s)	251
SlaI	CTCGAG	1 cut(s)	101
SmlI	CTYRAG	1 cut(s)	101
SmoI	CTYRAG	1 cut(s)	101
Sse9I	AATT	5 cut(s)	4, 20, 73, 193, 203
SseBI	AGGCCT	1 cut(s)	99
SspI	AATATT	2 cut(s)	242, 451
SspMI	CTAG	1 cut(s)	369
StuI	AGGCCT	1 cut(s)	99
StyD4I	CCNGG	2 cut(s)	35, 256
StyI	CCWWGG	1 cut(s)	247
TaaI	ACNGT	2 cut(s)	361, 386
TaqI	TCGA	1 cut(s)	102
TasI	AATT	5 cut(s)	4, 20, 73, 193, 203
TfiI	GAWTC	1 cut(s)	86
Tru1I	TTAA	3 cut(s)	135, 354, 565
Tru9I	TTAA	3 cut(s)	135, 354, 565
TscAI	CASTG	2 cut(s)	96, 391
TseFI	GTSAC	1 cut(s)	502
Tsp45I	GTSAC	1 cut(s)	502
TspDTI	ATGAA	6 cut(s)	17, 327, 414, 450, 461, 470
TspRI	CASTG	2 cut(s)	96, 391
VpaK11BI	GGWCC	1 cut(s)	251
XagI	CCTNNNNNAGG	1 cut(s)	104
XapI	RAATTY	2 cut(s)	193, 203
XceI	RCATGY	2 cut(s)	215, 555
XhoI	CTCGAG	1 cut(s)	101
XmiI	GTMKAC	1 cut(s)	147
XspI	CTAG	1 cut(s)	369

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.