Rmu_co8075908.1_g000001

PLATZ transcription factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8075908.1
Physical Location & Seq
Forward (+)
29 .. 580
552 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8075908.1_g000001.1.cds

Sequence Viewer

Length: 445 bp
atgttgataccgccatggctggagcagttgctgacctcgtcgttcttcaccatctgccgtactcacggcgacgcagccaggagtgaatgcaacatgttctgcttggactgcggtggagatgcattttgcttctactgccgctcctccagacacaaagaccaccaagtgatccagataaggaggtcttcttaccatgatgtggtgagggtttcggagatacaaaaggttctggacattagtggggttcagacctatgtgataaacagtgccagagttctgttcttgaatgagaggcctcaaccaaaagctggaatcaaaggagtcccccacatttgtgaaatctgtagcagaggcctcttggacccatttcgattctgctctctgggttgtaaggtgagcatttctccactctcaaacccccaatttgcttcacattgtgttcttt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

148

Amino Acids

16.67

Weight (kDa)

8.53

Isoelectric Point (pI)

56.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 199, 308
AccBSI CCGCTC 1 cut(s) 141
AciI CCGC 3 cut(s) 11, 111, 139
AclWI GGATC 1 cut(s) 163
AdeI CACNNNGTG 2 cut(s) 166, 437
AfaI GTAC 1 cut(s) 61
AfiI CCNNNNNNNGG 2 cut(s) 199, 308
AflIII ACRYGT 1 cut(s) 93
AgsI TTSAA 1 cut(s) 286
AjnI CCWGG 1 cut(s) 77
AleI CACNNNNGTG 1 cut(s) 333
AluBI AGCT 1 cut(s) 308
AluI AGCT 1 cut(s) 308
AlwI GGATC 1 cut(s) 163
AlwNI CAGNNNCTG 1 cut(s) 31
AoxI GGCC 2 cut(s) 293, 352
ApeKI GCWGC 1 cut(s) 74
AspS9I GGNCC 1 cut(s) 361
AsuHPI GGTGA 3 cut(s) 40, 214, 406
AvaII GGWCC 1 cut(s) 361
BbsI GAAGAC 1 cut(s) 177
BbvI GCAGC 1 cut(s) 86
BccI CCATC 1 cut(s) 59
BceAI ACGGC 2 cut(s) 42, 82
BciT130I CCWGG 1 cut(s) 79
BfmI CTRYAG 1 cut(s) 343
BisI GCNGC 2 cut(s) 75, 139
BlsI GCNGC 2 cut(s) 76, 140
Bme1390I CCNGG 1 cut(s) 79
Bme18I GGWCC 1 cut(s) 361
BmgT120I GGNCC 1 cut(s) 361
BmiI GGNNCC 1 cut(s) 363
BmrFI CCNGG 1 cut(s) 79
BmsI GCATC 1 cut(s) 109
BpiI GAAGAC 1 cut(s) 177
BplI GAGNNNNNCTC 2 cut(s) 388, 420
BpmI CTGGAG 2 cut(s) 41, 130
BsaJI CCNNGG 1 cut(s) 14
BsaXI ACNNNNNCTCC 2 cut(s) 125, 155
Bsc4I CCNNNNNNNGG 2 cut(s) 199, 308
BseBI CCWGG 1 cut(s) 79
BseDI CCNNGG 1 cut(s) 14
BseLI CCNNNNNNNGG 2 cut(s) 199, 308
BseRI GAGGAG 1 cut(s) 133
BseXI GCAGC 1 cut(s) 86
BshFI GGCC 2 cut(s) 295, 354
BslFI GGGAC 1 cut(s) 308
BslI CCNNNNNNNGG 2 cut(s) 199, 308
BsmFI GGGAC 1 cut(s) 308
BsmI GAATGC 1 cut(s) 92
BsnI GGCC 2 cut(s) 295, 354
Bsp143I GATC 1 cut(s) 168
Bsp19I CCATGG 1 cut(s) 14
BspACI CCGC 3 cut(s) 11, 111, 139
BspANI GGCC 2 cut(s) 295, 354
BspLI GGNNCC 1 cut(s) 363
BspPI GGATC 1 cut(s) 163
BsrBI CCGCTC 1 cut(s) 141
BssECI CCNNGG 1 cut(s) 14
BssMI GATC 1 cut(s) 168
BssT1I CCWWGG 1 cut(s) 14
Bst2UI CCWGG 1 cut(s) 79
Bst4CI ACNGT 1 cut(s) 266
BstDSI CCRYGG 1 cut(s) 14
BstKTI GATC 1 cut(s) 171
BstMBI GATC 1 cut(s) 168
BstMWI GCNNNNNNNGC 2 cut(s) 108, 135
BstNI CCWGG 1 cut(s) 79
BstNSI RCATGY 1 cut(s) 97
BstSCI CCNGG 1 cut(s) 77
BstSFI CTRYAG 1 cut(s) 343
BstV1I GCAGC 1 cut(s) 86
BstV2I GAAGAC 1 cut(s) 177
BsuRI GGCC 2 cut(s) 295, 354
BtgI CCRYGG 1 cut(s) 14
BtsIMutI CAGTG 1 cut(s) 271
CaiI CAGNNNCTG 1 cut(s) 31
Cfr13I GGNCC 1 cut(s) 361
CseI GACGC 1 cut(s) 80
Csp6I GTAC 1 cut(s) 60
CviAII CATG 3 cut(s) 15, 94, 194
CviJI RGCY 5 cut(s) 19, 77, 295, 308, 354
CviKI_1 RGCY 5 cut(s) 19, 77, 295, 308, 354
CviQI GTAC 1 cut(s) 60
DpnI GATC 1 cut(s) 170
DpnII GATC 1 cut(s) 168
DraIII CACNNNGTG 2 cut(s) 166, 437
Eco130I CCWWGG 1 cut(s) 14
Eco147I AGGCCT 2 cut(s) 295, 354
Eco47I GGWCC 1 cut(s) 361
EcoRII CCWGG 1 cut(s) 77
EcoT14I CCWWGG 1 cut(s) 14
EcoT22I ATGCAT 1 cut(s) 124
ErhI CCWWGG 1 cut(s) 14
FaeI CATG 3 cut(s) 18, 97, 197
FaiI YATR 4 cut(s) 16, 95, 195, 255
FalI AAGNNNNNCTT 2 cut(s) 169, 201
FaqI GGGAC 1 cut(s) 308
FatI CATG 3 cut(s) 14, 93, 193
Fnu4HI GCNGC 2 cut(s) 75, 139
Fsp4HI GCNGC 2 cut(s) 75, 139
GluI GCNGC 2 cut(s) 75, 139
GsuI CTGGAG 2 cut(s) 41, 130
HaeIII GGCC 2 cut(s) 295, 354
HgaI GACGC 1 cut(s) 80
Hin1II CATG 3 cut(s) 18, 97, 197
HinfI GANTC 3 cut(s) 312, 321, 372
HphI GGTGA 3 cut(s) 40, 214, 406
Hpy188I TCNGA 2 cut(s) 214, 249
Hpy188III TCNNGA 4 cut(s) 147, 172, 230, 283
Hpy99I CGWCG 2 cut(s) 43, 74
HpyCH4III ACNGT 1 cut(s) 266
HpyCH4V TGCA 2 cut(s) 90, 122
HpyF10VI GCNNNNNNNGC 2 cut(s) 108, 135
Hsp92II CATG 3 cut(s) 18, 97, 197
Kzo9I GATC 1 cut(s) 168
LmnI GCTCC 2 cut(s) 22, 146
LpnPI CCDG 9 cut(s) 5, 64, 91, 160, 185, 215, 283, 294, 368
Lsp1109I GCAGC 1 cut(s) 86
LweI GCATC 1 cut(s) 109
MalI GATC 1 cut(s) 170
MbiI CCGCTC 1 cut(s) 141
MboI GATC 1 cut(s) 168
MboII GAAGA 2 cut(s) 37, 177
MluCI AATT 1 cut(s) 422
MlyI GAGTC 1 cut(s) 330
MnlI CCTC 8 cut(s) 46, 154, 174, 198, 285, 306, 344, 365
Mph1103I ATGCAT 1 cut(s) 124
MslI CAYNNNNRTG 1 cut(s) 333
MspR9I CCNGG 1 cut(s) 79
Mva1269I GAATGC 1 cut(s) 92
MvaI CCWGG 1 cut(s) 79
MwoI GCNNNNNNNGC 2 cut(s) 108, 135
NcoI CCATGG 1 cut(s) 14
NdeII GATC 1 cut(s) 168
NlaIII CATG 3 cut(s) 18, 97, 197
NlaIV GGNNCC 1 cut(s) 363
NsiI ATGCAT 1 cut(s) 124
NspI RCATGY 1 cut(s) 97
OliI CACNNNNGTG 1 cut(s) 333
PceI AGGCCT 2 cut(s) 295, 354
PciI ACATGT 1 cut(s) 93
PctI GAATGC 1 cut(s) 92
PfeI GAWTC 2 cut(s) 312, 372
PflFI GACNNNGTC 1 cut(s) 37
PflMI CCANNNNNTGG 2 cut(s) 199, 308
PkrI GCNGC 2 cut(s) 76, 140
PleI GAGTC 1 cut(s) 329
PpsI GAGTC 1 cut(s) 329
PscI ACATGT 1 cut(s) 93
Psp6I CCWGG 1 cut(s) 77
PspGI CCWGG 1 cut(s) 77
PspN4I GGNNCC 1 cut(s) 363
PspPI GGNCC 1 cut(s) 361
PstNI CAGNNNCTG 1 cut(s) 31
PsyI GACNNNGTC 1 cut(s) 37
RsaI GTAC 1 cut(s) 61
RsaNI GTAC 1 cut(s) 60
RseI CAYNNNNRTG 1 cut(s) 333
SatI GCNGC 2 cut(s) 75, 139
Sau3AI GATC 1 cut(s) 168
Sau96I GGNCC 1 cut(s) 361
SchI GAGTC 1 cut(s) 330
ScrFI CCNGG 1 cut(s) 79
SetI ASST 6 cut(s) 38, 185, 228, 254, 310, 396
SfaNI GCATC 1 cut(s) 109
SfcI CTRYAG 1 cut(s) 343
SinI GGWCC 1 cut(s) 361
SmiMI CAYNNNNRTG 1 cut(s) 333
Sse9I AATT 1 cut(s) 422
SseBI AGGCCT 2 cut(s) 295, 354
SsiI CCGC 3 cut(s) 11, 111, 139
StuI AGGCCT 2 cut(s) 295, 354
StyD4I CCNGG 1 cut(s) 77
StyI CCWWGG 1 cut(s) 14
TaaI ACNGT 1 cut(s) 266
TaqI TCGA 1 cut(s) 370
TasI AATT 1 cut(s) 422
TauI GCSGC 1 cut(s) 141
TfiI GAWTC 2 cut(s) 312, 372
TscAI CASTG 1 cut(s) 271
TseI GCWGC 1 cut(s) 74
TspRI CASTG 1 cut(s) 271
Tth111I GACNNNGTC 1 cut(s) 37
Van91I CCANNNNNTGG 2 cut(s) 199, 308
VpaK11BI GGWCC 1 cut(s) 361
XceI RCATGY 1 cut(s) 97
Zsp2I ATGCAT 1 cut(s) 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.