Rmu_co8114364.1_g000001

Phosphatidylinositol phosphatidylcholine transfer protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8114364.1
Physical Location & Seq
Forward (+)
1 .. 614
614 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8114364.1_g000001.1.cds

Sequence Viewer

Length: 252 bp
ctaagaagcacattgatcagagcaccactattcttgatgtacaaggagtggggcttaaaaatttcaataaatctgcgagggaacttattcagtgccttcagaagattgatggcgacaattatcctgagaccctgaaccgtatgttcatcattaatgctggttctggatttaggcttttatggaacactgtcaaatctttccttgatcccaagaccactgcaaaaatcaatgtaagcatttgttttgctcacc

Protein Analysis

83

Amino Acids

9.37

Weight (kDa)

9.34

Isoelectric Point (pI)

30.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 199
AcsI RAATTY 1 cut(s) 60
AcuI CTGAAG 1 cut(s) 82
AfaI GTAC 1 cut(s) 41
AgsI TTSAA 1 cut(s) 66
Alw21I GWGCWC 1 cut(s) 25
Alw26I GTCTC 1 cut(s) 121
AlwI GGATC 1 cut(s) 199
ApoI RAATTY 1 cut(s) 60
AseI ATTAAT 1 cut(s) 152
Asp700I GAANNNNTTC 1 cut(s) 86
AsuHPI GGTGA 1 cut(s) 241
Bbv12I GWGCWC 1 cut(s) 25
BccI CCATC 1 cut(s) 103
BclI TGATCA 1 cut(s) 15
BcoDI GTCTC 1 cut(s) 121
BsaI GGTCTC 1 cut(s) 121
BseMII CTCAG 1 cut(s) 116
BsiHKAI GWGCWC 1 cut(s) 25
BsmAI GTCTC 1 cut(s) 121
Bso31I GGTCTC 1 cut(s) 121
Bsp1286I GDGCHC 1 cut(s) 25
Bsp1407I TGTACA 1 cut(s) 39
Bsp143I GATC 2 cut(s) 15, 204
BspCNI CTCAG 1 cut(s) 117
BspPI GGATC 1 cut(s) 199
BspTNI GGTCTC 1 cut(s) 121
BsrGI TGTACA 1 cut(s) 39
BssMI GATC 2 cut(s) 15, 204
Bst4CI ACNGT 2 cut(s) 139, 189
BstAUI TGTACA 1 cut(s) 39
BstDEI CTNAG 2 cut(s) 2, 125
BstKTI GATC 2 cut(s) 18, 207
BstMAI GTCTC 1 cut(s) 121
BstMBI GATC 2 cut(s) 15, 204
BtsI GCAGTG 1 cut(s) 215
BtsIMutI CAGTG 3 cut(s) 97, 185, 215
Csp6I GTAC 1 cut(s) 40
CspCI CAANNNNNGTGG 2 cut(s) 15, 50
CviJI RGCY 2 cut(s) 54, 174
CviKI_1 RGCY 2 cut(s) 54, 174
CviQI GTAC 1 cut(s) 40
DdeI CTNAG 2 cut(s) 2, 125
DpnI GATC 2 cut(s) 17, 206
DpnII GATC 2 cut(s) 15, 204
Eco31I GGTCTC 1 cut(s) 121
Eco57I CTGAAG 1 cut(s) 82
FaiI YATR 2 cut(s) 142, 180
FbaI TGATCA 1 cut(s) 15
HphI GGTGA 1 cut(s) 241
Hpy188I TCNGA 2 cut(s) 20, 101
Hpy188III TCNNGA 3 cut(s) 34, 124, 164
HpyAV CCTTC 1 cut(s) 106
HpyCH4III ACNGT 2 cut(s) 139, 189
HpyCH4V TGCA 1 cut(s) 220
HpyF3I CTNAG 2 cut(s) 2, 125
Ksp22I TGATCA 1 cut(s) 15
Kzo9I GATC 2 cut(s) 15, 204
LpnPI CCDG 4 cut(s) 137, 143, 145, 149
MalI GATC 2 cut(s) 17, 206
MboI GATC 2 cut(s) 15, 204
MboII GAAGA 1 cut(s) 114
MhlI GDGCHC 1 cut(s) 25
MluCI AATT 2 cut(s) 60, 117
MnlI CCTC 1 cut(s) 71
MroXI GAANNNNTTC 1 cut(s) 86
MseI TTAA 2 cut(s) 56, 152
NdeII GATC 2 cut(s) 15, 204
PdmI GAANNNNTTC 1 cut(s) 86
PshBI ATTAAT 1 cut(s) 152
RsaI GTAC 1 cut(s) 41
RsaNI GTAC 1 cut(s) 40
SaqAI TTAA 2 cut(s) 56, 152
Sau3AI GATC 2 cut(s) 15, 204
SduI GDGCHC 1 cut(s) 25
SgeI CNNG 9 cut(s) 46, 55, 89, 136, 144, 170, 176, 214, 222
Sse9I AATT 2 cut(s) 60, 117
TaaI ACNGT 2 cut(s) 139, 189
TasI AATT 2 cut(s) 60, 117
TatI WGTACW 1 cut(s) 39
Tru1I TTAA 2 cut(s) 56, 152
Tru9I TTAA 2 cut(s) 56, 152
TscAI CASTG 3 cut(s) 97, 192, 222
TspDTI ATGAA 1 cut(s) 135
TspRI CASTG 3 cut(s) 97, 192, 222
VspI ATTAAT 1 cut(s) 152
XapI RAATTY 1 cut(s) 60
XmnI GAANNNNTTC 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.