Rmu_co8258425.1_g000001

belongs to the HisA HisF family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8258425.1
Physical Location & Seq
Reverse (-)
1 .. 782
782 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8258425.1_g000001.1.cds

Sequence Viewer

Length: 169 bp
atgtttccatttcaaggtttttcttatcgtatactaacatcttatctgatgtttgttcttaaggttagcggtggccgggaaggcagaccaattggagcttatgagctcgcaaaagcagttgaggagcttggagctagagaaattctgctaaactacattgattgctatg

Protein Analysis

56

Amino Acids

6.4

Weight (kDa)

6.11

Isoelectric Point (pI)

28.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 31
AciI CCGC 1 cut(s) 69
AcoI YGGCCR 1 cut(s) 73
AcsI RAATTY 1 cut(s) 141
AfiI CCNNNNNNNGG 1 cut(s) 14
AflII CTTAAG 1 cut(s) 59
AgsI TTSAA 1 cut(s) 14
AluBI AGCT 4 cut(s) 98, 106, 127, 134
AluI AGCT 4 cut(s) 98, 106, 127, 134
Alw21I GWGCWC 1 cut(s) 108
AoxI GGCC 1 cut(s) 73
ApoI RAATTY 1 cut(s) 141
AsuC2I CCSGG 1 cut(s) 77
BanII GRGCYC 1 cut(s) 108
Bbv12I GWGCWC 1 cut(s) 108
BcnI CCSGG 1 cut(s) 77
BfaI CTAG 1 cut(s) 135
BfrI CTTAAG 1 cut(s) 59
BglI GCCNNNNNGGC 1 cut(s) 81
Bme1390I CCNGG 1 cut(s) 77
BmrFI CCNGG 1 cut(s) 77
BpuMI CCSGG 1 cut(s) 77
Bsc4I CCNNNNNNNGG 1 cut(s) 14
BseLI CCNNNNNNNGG 1 cut(s) 14
BseRI GAGGAG 1 cut(s) 137
BshFI GGCC 1 cut(s) 75
BsiHKAI GWGCWC 1 cut(s) 108
BsiSI CCGG 1 cut(s) 76
BslI CCNNNNNNNGG 1 cut(s) 14
BsnI GGCC 1 cut(s) 75
Bsp1286I GDGCHC 1 cut(s) 108
BspACI CCGC 1 cut(s) 69
BspANI GGCC 1 cut(s) 75
BspTI CTTAAG 1 cut(s) 59
BssNAI GTATAC 1 cut(s) 32
Bst1107I GTATAC 1 cut(s) 32
BstAFI CTTAAG 1 cut(s) 59
BstC8I GCNNGC 1 cut(s) 108
BstMWI GCNNNNNNNGC 1 cut(s) 81
BstSCI CCNGG 1 cut(s) 75
BstZ17I GTATAC 1 cut(s) 32
BsuRI GGCC 1 cut(s) 75
Cac8I GCNNGC 1 cut(s) 108
CviJI RGCY 5 cut(s) 75, 98, 106, 127, 134
CviKI_1 RGCY 5 cut(s) 75, 98, 106, 127, 134
EaeI YGGCCR 1 cut(s) 73
Ecl136II GAGCTC 1 cut(s) 106
Eco24I GRGCYC 1 cut(s) 108
Eco53kI GAGCTC 1 cut(s) 106
EcoICRI GAGCTC 1 cut(s) 106
EcoT38I GRGCYC 1 cut(s) 108
FaiI YATR 3 cut(s) 32, 102, 168
FblI GTMKAC 1 cut(s) 31
FriOI GRGCYC 1 cut(s) 108
FspBI CTAG 1 cut(s) 135
HaeIII GGCC 1 cut(s) 75
HapII CCGG 1 cut(s) 76
HpaII CCGG 1 cut(s) 76
Hpy166II GTNNAC 1 cut(s) 32
Hpy188I TCNGA 1 cut(s) 48
Hpy8I GTNNAC 1 cut(s) 32
HpyAV CCTTC 1 cut(s) 74
HpyF10VI GCNNNNNNNGC 1 cut(s) 81
LmnI GCTCC 3 cut(s) 95, 124, 131
LpnPI CCDG 1 cut(s) 89
MaeI CTAG 1 cut(s) 135
MfeI CAATTG 1 cut(s) 90
MhlI GDGCHC 1 cut(s) 108
MluCI AATT 2 cut(s) 90, 141
MnlI CCTC 1 cut(s) 115
MseI TTAA 1 cut(s) 60
MspCI CTTAAG 1 cut(s) 59
MspI CCGG 1 cut(s) 76
MspR9I CCNGG 1 cut(s) 77
MunI CAATTG 1 cut(s) 90
MwoI GCNNNNNNNGC 1 cut(s) 81
NciI CCSGG 1 cut(s) 77
Psp124BI GAGCTC 1 cut(s) 108
SacI GAGCTC 1 cut(s) 108
SaqAI TTAA 1 cut(s) 60
ScrFI CCNGG 1 cut(s) 77
SduI GDGCHC 1 cut(s) 108
SetI ASST 6 cut(s) 19, 66, 100, 108, 129, 136
SgeI CNNG 6 cut(s) 26, 88, 89, 119, 140, 147
SmlI CTYRAG 1 cut(s) 59
SmoI CTYRAG 1 cut(s) 59
Sse9I AATT 2 cut(s) 90, 141
SsiI CCGC 1 cut(s) 69
SspMI CTAG 1 cut(s) 135
SstI GAGCTC 1 cut(s) 108
StyD4I CCNGG 1 cut(s) 75
TasI AATT 2 cut(s) 90, 141
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
Vha464I CTTAAG 1 cut(s) 59
XapI RAATTY 1 cut(s) 141
XmiI GTMKAC 1 cut(s) 31
XspI CTAG 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.