Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8261369.1

Orthogroup ID

OG0003738

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 776

Gene Structure 775 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8261369.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 775 bp

atgaagaattttgttgaagaaattgcttgtggtgcttatcatgttgcagtcttaacttcgagaactgaagtttacacttggggaaagggtgcaaatggtagattaggtcttggggatacagaggataaattttcaccaacattagttgaagctctaagagacaaacaagtcaaaagtatcgtttgtggcactaactttacagcagccatctgtcttcataaatgggtctctggtgtcgatcaatcaatgtgttctggctgtcgccttccgtttaattttaaaagaaaaagacacaactgctacaattgtggacttgtattatgccattcatgcagtagcaaaaagtgcctcaaggcttcgatggcaccaaatccaaacaaaccatatcgagtttgtgataattgttttgggaaactcagaaaggcctctgaaaccaactcttcatctggctccgctttgaaaaaaggaagtaatcagggatttgctgaactgagtgaaaaaaatattaaagatttggacactggttcatccacaagaaacaagaaactagattttagcagtaattgtgttgctccctttccaaatggcatttctgagcgccgtgcattcagtgggactaaatctttcaacccagtatttggatcttccaaaaagtttttctcagcttctcttcctggatcaagaattgcttctcgagcaacatcaccaacatcgagacgatctagtccacctcgtgccaaaacgccaacccctgctctctcagggatcacattgc

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

BRX BRX_N BRX_assoc FYVE PH_12 RCC1

Protein Analysis

258

Amino Acids

27.89

Weight (kDa)

9.79

Isoelectric Point (pI)

46.26

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003738)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G12350 AT5G19420 AT5G19420 AT5G19420
fragaria_vesca	FvH4_7g02960 FvH4_7g02960 FvH4_7g02960 FvH4_7g02960
malus_domestica	MD02G1288400.v1.1 MD07G1038100.v1.1 MD07G1038400.v1.1 MD13G1037300.v1.1
prunus_persica	Prupe.2G034600_v2.0.a1 Prupe.2G034600_v2.0.a1 Prupe.2G034600_v2.0.a1
pyrus_communis	pycom02g24410 pycom05g01140 pycom07g02640 pycom07g02670 pycom16g06500
rosa_chinensis	RchiOBHm_Chr1g0323931
rosa_laevigata	RLG00000030242
rosa_multiflora	Rmu_co8261369.1_g000001 Rmu_sc0001449.1_g000001 Rmu_sc0011010.1_g000012 Rmu_sc0012343.1_g000006 Rmu_sc0012343.1_g000007
rosa_roxburghii	Rroxscaffold_4G00326110
rosa_rugosa	Rorug01G0040600
rosa_samantha	Rh1AG058500 Rh1BG049600 Rh1CG060400 Rh1DG064400
rosa_wichuraiana	Rw0G011380

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	2 cut(s)	167, 723
AccB1I	GGYRCC	1 cut(s)	364
AccB7I	CCANNNNNTGG	1 cut(s)	638
AciI	CCGC	1 cut(s)	453
AclWI	GGATC	3 cut(s)	649, 685, 773
AcsI	RAATTY	2 cut(s)	7, 128
AcuI	CTGAAG	1 cut(s)	87
AdeI	CACNNNGTG	1 cut(s)	734
AfiI	CCNNNNNNNGG	1 cut(s)	638
AgsI	TTSAA	4 cut(s)	17, 149, 460, 628
AjnI	CCWGG	1 cut(s)	673
AjuI	GAANNNNNNNTTGG	4 cut(s)	574, 606, 641, 673
AluBI	AGCT	2 cut(s)	152, 665
AluI	AGCT	2 cut(s)	152, 665
Alw26I	GTCTC	3 cut(s)	153, 232, 709
AlwI	GGATC	3 cut(s)	649, 685, 773
Ama87I	CYCGRG	1 cut(s)	693
AoxI	GGCC	1 cut(s)	423
ApeKI	GCWGC	1 cut(s)	203
ApoI	RAATTY	2 cut(s)	7, 128
Asp700I	GAANNNNTTC	1 cut(s)	688
AspLEI	GCGC	1 cut(s)	600
AsuHPI	GGTGA	2 cut(s)	126, 696
AvaI	CYCGRG	1 cut(s)	693
BanI	GGYRCC	1 cut(s)	364
BauI	CACGAG	1 cut(s)	732
BbsI	GAAGAC	1 cut(s)	206
BbvI	GCAGC	1 cut(s)	215
BccI	CCATC	2 cut(s)	215, 355
BceAI	ACGGC	1 cut(s)	585
BciT130I	CCWGG	1 cut(s)	675
BciVI	GTATCC	1 cut(s)	109
BcoDI	GTCTC	3 cut(s)	153, 232, 709
BfaI	CTAG	2 cut(s)	548, 723
BfoI	RGCGCY	1 cut(s)	601
BfuI	GTATCC	1 cut(s)	109
BisI	GCNGC	1 cut(s)	204
BlsI	GCNGC	1 cut(s)	205
Bme1390I	CCNGG	1 cut(s)	675
BmeT110I	CYCGRG	1 cut(s)	693
BmiI	GGNNCC	2 cut(s)	366, 451
BmrFI	CCNGG	1 cut(s)	675
BmrI	ACTGGG	1 cut(s)	626
BmuI	ACTGGG	1 cut(s)	626
BpiI	GAAGAC	1 cut(s)	206
BpuEI	CTTGAG	1 cut(s)	335
BsaI	GGTCTC	1 cut(s)	232
Bsc4I	CCNNNNNNNGG	1 cut(s)	638
Bse1I	ACTGG	2 cut(s)	526, 632
Bse3DI	GCAATG	1 cut(s)	770
BseBI	CCWGG	1 cut(s)	675
BseGI	GGATG	1 cut(s)	527
BseLI	CCNNNNNNNGG	1 cut(s)	638
BseMI	GCAATG	1 cut(s)	770
BseMII	CTCAG	5 cut(s)	430, 482, 585, 675, 774
BseNI	ACTGG	2 cut(s)	526, 632
BseXI	GCAGC	1 cut(s)	215
BshFI	GGCC	1 cut(s)	425
BshNI	GGYRCC	1 cut(s)	364
BsiHKCI	CYCGRG	1 cut(s)	693
BslFI	GGGAC	1 cut(s)	628
BslI	CCNNNNNNNGG	1 cut(s)	638
BsmAI	GTCTC	3 cut(s)	153, 232, 709
BsmBI	CGTCTC	1 cut(s)	709
BsmFI	GGGAC	1 cut(s)	628
BsmI	GAATGC	1 cut(s)	605
BsnI	GGCC	1 cut(s)	425
Bso31I	GGTCTC	1 cut(s)	232
BsoBI	CYCGRG	1 cut(s)	693
Bsp143I	GATC	5 cut(s)	238, 641, 677, 719, 765
BspACI	CCGC	1 cut(s)	453
BspANI	GGCC	1 cut(s)	425
BspCNI	CTCAG	5 cut(s)	429, 483, 586, 674, 773
BspLI	GGNNCC	2 cut(s)	366, 451
BspPI	GGATC	3 cut(s)	649, 685, 773
BspT107I	GGYRCC	1 cut(s)	364
BspTNI	GGTCTC	1 cut(s)	232
BsrDI	GCAATG	1 cut(s)	770
BsrI	ACTGG	2 cut(s)	526, 632
BssMI	GATC	5 cut(s)	238, 641, 677, 719, 765
BssSI	CACGAG	1 cut(s)	732
Bst2BI	CACGAG	1 cut(s)	732
Bst2UI	CCWGG	1 cut(s)	675
Bst6I	CTCTTC	2 cut(s)	445, 675
BstAPI	GCANNNNNTGC	1 cut(s)	345
BstDEI	CTNAG	6 cut(s)	155, 416, 491, 594, 661, 760
BstF5I	GGATG	1 cut(s)	527
BstH2I	RGCGCY	1 cut(s)	601
BstHHI	GCGC	1 cut(s)	600
BstKTI	GATC	5 cut(s)	241, 644, 680, 722, 768
BstMAI	GTCTC	3 cut(s)	153, 232, 709
BstMBI	GATC	5 cut(s)	238, 641, 677, 719, 765
BstMWI	GCNNNNNNNGC	5 cut(s)	32, 330, 345, 362, 695
BstNI	CCWGG	1 cut(s)	675
BstSCI	CCNGG	1 cut(s)	673
BstV1I	GCAGC	1 cut(s)	215
BstV2I	GAAGAC	1 cut(s)	206
BstX2I	RGATCY	1 cut(s)	641
BstYI	RGATCY	1 cut(s)	641
BsuI	GTATCC	1 cut(s)	109
BsuRI	GGCC	1 cut(s)	425
BtsCI	GGATG	1 cut(s)	527
BtsIMutI	CAGTG	2 cut(s)	519, 616
CfoI	GCGC	1 cut(s)	600
CviAII	CATG	2 cut(s)	41, 330
CviJI	RGCY	7 cut(s)	152, 206, 258, 356, 425, 450, 665
CviKI_1	RGCY	7 cut(s)	152, 206, 258, 356, 425, 450, 665
DdeI	CTNAG	6 cut(s)	155, 416, 491, 594, 661, 760
DpnI	GATC	5 cut(s)	240, 643, 679, 721, 767
DpnII	GATC	5 cut(s)	238, 641, 677, 719, 765
DraI	TTTAAA	1 cut(s)	280
DraIII	CACNNNGTG	1 cut(s)	734
DrdI	GACNNNNNNGTC	2 cut(s)	167, 723
DseDI	GACNNNNNNGTC	2 cut(s)	167, 723
Eam1104I	CTCTTC	2 cut(s)	445, 675
EarI	CTCTTC	2 cut(s)	445, 675
Eco147I	AGGCCT	1 cut(s)	425
Eco31I	GGTCTC	1 cut(s)	232
Eco57I	CTGAAG	1 cut(s)	87
Eco88I	CYCGRG	1 cut(s)	693
EcoRII	CCWGG	1 cut(s)	673
Esp3I	CGTCTC	1 cut(s)	709
FaeI	CATG	2 cut(s)	44, 333
FaiI	YATR	5 cut(s)	42, 219, 322, 331, 385
FalI	AAGNNNNNCTT	2 cut(s)	673, 705
FaqI	GGGAC	1 cut(s)	628
FatI	CATG	2 cut(s)	40, 329
Fnu4HI	GCNGC	1 cut(s)	204
FokI	GGATG	1 cut(s)	514
Fsp4HI	GCNGC	1 cut(s)	204
FspBI	CTAG	2 cut(s)	548, 723
GlaI	GCGC	1 cut(s)	599
GluI	GCNGC	1 cut(s)	204
HaeII	RGCGCY	1 cut(s)	601
HaeIII	GGCC	1 cut(s)	425
HhaI	GCGC	1 cut(s)	600
Hin1II	CATG	2 cut(s)	44, 333
Hin6I	GCGC	1 cut(s)	598
HinP1I	GCGC	1 cut(s)	598
HphI	GGTGA	2 cut(s)	126, 696
Hpy166II	GTNNAC	3 cut(s)	73, 311, 728
Hpy188I	TCNGA	3 cut(s)	419, 430, 595
Hpy188III	TCNNGA	4 cut(s)	60, 681, 693, 714
Hpy8I	GTNNAC	3 cut(s)	73, 311, 728
HpyAV	CCTTC	1 cut(s)	275
HpyCH4V	TGCA	4 cut(s)	47, 92, 333, 605
HpyF10VI	GCNNNNNNNGC	5 cut(s)	32, 330, 345, 362, 695
HpyF3I	CTNAG	6 cut(s)	155, 416, 491, 594, 661, 760
Hsp92II	CATG	2 cut(s)	44, 333
HspAI	GCGC	1 cut(s)	598
Kzo9I	GATC	5 cut(s)	238, 641, 677, 719, 765
LmnI	GCTCC	2 cut(s)	455, 577
Lsp1109I	GCAGC	1 cut(s)	215
MaeI	CTAG	2 cut(s)	548, 723
MalI	GATC	5 cut(s)	240, 643, 679, 721, 767
MboI	GATC	5 cut(s)	238, 641, 677, 719, 765
MboII	GAAGA	6 cut(s)	16, 29, 206, 432, 636, 662
MfeI	CAATTG	1 cut(s)	304
MflI	RGATCY	1 cut(s)	641
MluCI	AATT	8 cut(s)	7, 21, 128, 274, 304, 400, 562, 684
MnlI	CCTC	4 cut(s)	115, 359, 436, 741
MroXI	GAANNNNTTC	1 cut(s)	688
MseI	TTAA	4 cut(s)	53, 273, 279, 507
MspR9I	CCNGG	1 cut(s)	675
MunI	CAATTG	1 cut(s)	304
Mva1269I	GAATGC	1 cut(s)	605
MvaI	CCWGG	1 cut(s)	675
MwoI	GCNNNNNNNGC	5 cut(s)	32, 330, 345, 362, 695
NdeII	GATC	5 cut(s)	238, 641, 677, 719, 765
NlaIII	CATG	2 cut(s)	44, 333
NlaIV	GGNNCC	2 cut(s)	366, 451
PaeR7I	CTCGAG	1 cut(s)	693
PceI	AGGCCT	1 cut(s)	425
PctI	GAATGC	1 cut(s)	605
PdmI	GAANNNNTTC	1 cut(s)	688
PflMI	CCANNNNNTGG	1 cut(s)	638
PfoI	TCCNGGA	1 cut(s)	673
PkrI	GCNGC	1 cut(s)	205
Psp6I	CCWGG	1 cut(s)	673
PspGI	CCWGG	1 cut(s)	673
PspN4I	GGNNCC	2 cut(s)	366, 451
PsuI	RGATCY	1 cut(s)	641
SaqAI	TTAA	4 cut(s)	53, 273, 279, 507
SatI	GCNGC	1 cut(s)	204
Sau3AI	GATC	5 cut(s)	238, 641, 677, 719, 765
ScrFI	CCNGG	1 cut(s)	675
SetI	ASST	4 cut(s)	109, 154, 667, 733
Sfr274I	CTCGAG	1 cut(s)	693
SlaI	CTCGAG	1 cut(s)	693
SmlI	CTYRAG	2 cut(s)	350, 693
SmoI	CTYRAG	2 cut(s)	350, 693
Sse9I	AATT	8 cut(s)	7, 21, 128, 274, 304, 400, 562, 684
SseBI	AGGCCT	1 cut(s)	425
SsiI	CCGC	1 cut(s)	453
SspI	AATATT	1 cut(s)	505
SspMI	CTAG	2 cut(s)	548, 723
StuI	AGGCCT	1 cut(s)	425
StyD4I	CCNGG	1 cut(s)	673
TaqI	TCGA	6 cut(s)	59, 237, 359, 388, 694, 713
TasI	AATT	8 cut(s)	7, 21, 128, 274, 304, 400, 562, 684
Tru1I	TTAA	4 cut(s)	53, 273, 279, 507
Tru9I	TTAA	4 cut(s)	53, 273, 279, 507
TscAI	CASTG	2 cut(s)	526, 616
TseI	GCWGC	1 cut(s)	203
TspDTI	ATGAA	5 cut(s)	17, 206, 318, 432, 516
TspGWI	ACGGA	1 cut(s)	258
TspRI	CASTG	2 cut(s)	526, 616
Van91I	CCANNNNNTGG	1 cut(s)	638
XapI	RAATTY	2 cut(s)	7, 128
XhoI	CTCGAG	1 cut(s)	693
XmnI	GAANNNNTTC	1 cut(s)	688
XspI	CTAG	2 cut(s)	548, 723

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.