Rmu_co8312885.1_g000001

Protein of unknown function (DUF707)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8312885.1
Physical Location & Seq
Reverse (-)
140 .. 884
745 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8312885.1_g000001.1.cds

Sequence Viewer

Length: 423 bp
atgggtagatttgttacagatctgttctctaatctgaaccttttcttgtggaggtggcacttgcaggacttaaccatcaagccaaaatatcttgtaacctttactgtaggccatgctcagaaaaaaaatatagatgccgcagttaaaaagacaagtgaatgggatcagtttgaggggtcaaagcaggctatccatgtgagcattcagaagcaaactaaatggtggtgtgccaagcgttttttgcatcctgacattgtggcatcctatgaatacatattaatttgggatgaggatatcggtgtggagcactttaatgcagaggaatacataaaactagtaaggaaatatgggttggaagtatcacagtctggtttagaaccaaataatgggctaacatggcagatgacaaaggagaggtcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

140

Amino Acids

16.55

Weight (kDa)

7.85

Isoelectric Point (pI)

35.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 386
AciI CCGC 1 cut(s) 138
AclWI GGATC 1 cut(s) 171
AfiI CCNNNNNNNGG 1 cut(s) 386
AhlI ACTAGT 1 cut(s) 334
AjuI GAANNNNNNNTTGG 2 cut(s) 335, 367
Alw21I GWGCWC 1 cut(s) 309
AlwI GGATC 1 cut(s) 171
AoxI GGCC 1 cut(s) 109
ArsI GACNNNNNNTTYG 1 cut(s) 401
AseI ATTAAT 1 cut(s) 278
Asp700I GAANNNNTTC 1 cut(s) 41
Bbv12I GWGCWC 1 cut(s) 309
BccI CCATC 1 cut(s) 83
BcuI ACTAGT 1 cut(s) 334
BfaI CTAG 1 cut(s) 335
BfmI CTRYAG 1 cut(s) 105
BglII AGATCT 1 cut(s) 19
BisI GCNGC 1 cut(s) 138
BlsI GCNGC 1 cut(s) 139
BmsI GCATC 3 cut(s) 124, 253, 269
Bsc4I CCNNNNNNNGG 1 cut(s) 386
BseGI GGATG 3 cut(s) 244, 260, 292
BseLI CCNNNNNNNGG 1 cut(s) 386
BseMII CTCAG 1 cut(s) 131
BshFI GGCC 1 cut(s) 111
BsiHKAI GWGCWC 1 cut(s) 309
BslI CCNNNNNNNGG 1 cut(s) 386
BsmI GAATGC 1 cut(s) 201
BsnI GGCC 1 cut(s) 111
Bsp1286I GDGCHC 1 cut(s) 309
Bsp143I GATC 2 cut(s) 19, 163
BspACI CCGC 1 cut(s) 138
BspANI GGCC 1 cut(s) 111
BspCNI CTCAG 1 cut(s) 130
BspPI GGATC 1 cut(s) 171
BssMI GATC 2 cut(s) 19, 163
Bst4CI ACNGT 2 cut(s) 106, 366
BstC8I GCNNGC 1 cut(s) 186
BstDEI CTNAG 1 cut(s) 117
BstF5I GGATG 3 cut(s) 244, 260, 292
BstKTI GATC 2 cut(s) 22, 166
BstMBI GATC 2 cut(s) 19, 163
BstMWI GCNNNNNNNGC 2 cut(s) 241, 397
BstSFI CTRYAG 1 cut(s) 105
BstX2I RGATCY 1 cut(s) 19
BstYI RGATCY 1 cut(s) 19
BsuRI GGCC 1 cut(s) 111
BtsCI GGATG 3 cut(s) 244, 260, 292
Cac8I GCNNGC 1 cut(s) 186
CviAII CATG 3 cut(s) 113, 194, 396
CviJI RGCY 4 cut(s) 82, 111, 188, 391
CviKI_1 RGCY 4 cut(s) 82, 111, 188, 391
DdeI CTNAG 1 cut(s) 117
DpnI GATC 2 cut(s) 21, 165
DpnII GATC 2 cut(s) 19, 163
Eco32I GATATC 1 cut(s) 295
EcoRV GATATC 1 cut(s) 295
FaeI CATG 3 cut(s) 116, 197, 399
FaiI YATR 9 cut(s) 114, 131, 195, 267, 275, 329, 348, 397, 421
FatI CATG 3 cut(s) 112, 193, 395
Fnu4HI GCNGC 1 cut(s) 138
FokI GGATG 3 cut(s) 231, 247, 299
Fsp4HI GCNGC 1 cut(s) 138
FspBI CTAG 1 cut(s) 335
GluI GCNGC 1 cut(s) 138
HaeIII GGCC 1 cut(s) 111
Hin1II CATG 3 cut(s) 116, 197, 399
Hpy188I TCNGA 3 cut(s) 36, 120, 207
Hpy188III TCNNGA 1 cut(s) 248
HpyCH4III ACNGT 2 cut(s) 106, 366
HpyCH4V TGCA 3 cut(s) 64, 244, 317
HpyF10VI GCNNNNNNNGC 2 cut(s) 241, 397
HpyF3I CTNAG 1 cut(s) 117
Hsp92II CATG 3 cut(s) 116, 197, 399
Kzo9I GATC 2 cut(s) 19, 163
LmnI GCTCC 1 cut(s) 304
LpnPI CCDG 4 cut(s) 50, 170, 261, 354
LweI GCATC 3 cut(s) 124, 253, 269
MaeI CTAG 1 cut(s) 335
MaeIII GTNAC 2 cut(s) 13, 94
MalI GATC 2 cut(s) 21, 165
MboI GATC 2 cut(s) 19, 163
MflI RGATCY 1 cut(s) 19
MhlI GDGCHC 1 cut(s) 309
MluCI AATT 1 cut(s) 279
MmeI TCCRAC 1 cut(s) 333
MnlI CCTC 5 cut(s) 45, 166, 283, 313, 408
MroXI GAANNNNTTC 1 cut(s) 41
MseI TTAA 4 cut(s) 71, 144, 278, 312
MslI CAYNNNNRTG 1 cut(s) 312
Mva1269I GAATGC 1 cut(s) 201
MwoI GCNNNNNNNGC 2 cut(s) 241, 397
NdeII GATC 2 cut(s) 19, 163
NlaIII CATG 3 cut(s) 116, 197, 399
PctI GAATGC 1 cut(s) 201
PdmI GAANNNNTTC 1 cut(s) 41
PflMI CCANNNNNTGG 1 cut(s) 386
PkrI GCNGC 1 cut(s) 139
PshBI ATTAAT 1 cut(s) 278
PsuI RGATCY 1 cut(s) 19
RseI CAYNNNNRTG 1 cut(s) 312
SaqAI TTAA 4 cut(s) 71, 144, 278, 312
SatI GCNGC 1 cut(s) 138
Sau3AI GATC 2 cut(s) 19, 163
SduI GDGCHC 1 cut(s) 309
SetI ASST 4 cut(s) 42, 56, 101, 419
SfaNI GCATC 3 cut(s) 124, 253, 269
SfcI CTRYAG 1 cut(s) 105
SmiMI CAYNNNNRTG 1 cut(s) 312
SpeI ACTAGT 1 cut(s) 334
Sse9I AATT 1 cut(s) 279
SsiI CCGC 1 cut(s) 138
SspMI CTAG 1 cut(s) 335
TaaI ACNGT 2 cut(s) 106, 366
TasI AATT 1 cut(s) 279
TauI GCSGC 1 cut(s) 140
Tru1I TTAA 4 cut(s) 71, 144, 278, 312
Tru9I TTAA 4 cut(s) 71, 144, 278, 312
TspDTI ATGAA 1 cut(s) 282
Van91I CCANNNNNTGG 1 cut(s) 386
VspI ATTAAT 1 cut(s) 278
XmnI GAANNNNTTC 1 cut(s) 41
XspI CTAG 1 cut(s) 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.