Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000200.1

Orthogroup ID

OG0001946

Physical Location & Seq

Genomic Coordinates Forward (+)

51293 .. 53573

Gene Structure 2281 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000200.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 735 bp

atggaccctgttttgagcttgcagtgggaatataagaaaaccaaagagaaaatgaggtttgttgcgacagcttttgtggcgattctgtttggcttctttctaggagtgtcatttccaaccatttcgttaactaagatgaatttcccacccagccatttttcttccattgatatttcatacatagcggagaagtactcggggttctcaacccaagcactggtgaatgcctggtcttctttgaagagcaacagagatatctctgtaaaatacatccctaatgatgcaaaggacttaaccatcaagccaaaatatcttgtaacctttactgtaggccatgctcagaaaaaaaatatagatgccgcagttaaaaagacaagtgaatgggatcagtttgaggggtcaaagcaggctatccatgtgagcattcagaagcaaactaaatggtggtgtgccaagcgttttttgcatcctgacattgtggcatcctatgaatacatattaatttgggatgaggatatcggtgtggagcactttaatgcagaggaatacataaaactagtaaggaaatatgggttggaagtatcacagtctggtttagaaccaaataatgggctaacatggcagatgacaaaggagaggcagacagaggagaaacctggttggtgtaatgatccgcatttgccgccctgtgcagcgtatgtaactatatcttatccatcaccctctgggaaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF707

Protein Analysis

244

Amino Acids

27.92

Weight (kDa)

8.56

Isoelectric Point (pI)

32.17

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001946)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G27470 AT3G27470 AT3G27470 AT3G27470 AT3G27470
fragaria_vesca	FvH4_6g51770 FvH4_6g51770 FvH4_6g51770 FvH4_6g51770 FvH4_6g51770 FvH4_6g51770 FvH4_6g51770 FvH4_6g51770 FvH4_6g51770
malus_domestica	MD09G1022800.v1.1 MD17G1022000.v1.1
prunus_persica	Prupe.3G294100_v2.0.a1 Prupe.3G294100_v2.0.a1 Prupe.3G294100_v2.0.a1 Prupe.3G294100_v2.0.a1
pyrus_communis	pycom111g01910 pycom17g01910
rosa_chinensis	RchiOBHm_Chr2g0127631 RchiOBHm_Chr2g0173331
rosa_laevigata	RLG00000018948 RLG00000022179
rosa_multiflora	Rmu_co8312885.1_g000001 Rmu_sc0010961.1_g000004 Rmu_sc0033776.1_g000002 Rmu_ssc0000200.1_g000010
rosa_roxburghii	Rroxscaffold_2G00079050 Rroxscaffold_2G00116590 Rroxscaffold_2G00116600
rosa_rugosa	Rorug02G0272400 Rorug02G0567400 Rorug02G0567500
rosa_samantha	Rh2AG324300 Rh2AG647700 Rh2BG658200 Rh2CG311800 Rh2CG623700 Rh2DG351800 Rh2DG672000
rosa_wichuraiana	Rw2G026330 Rw2G053170

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	2 cut(s)	217, 608
AciI	CCGC	4 cut(s)	185, 360, 674, 683
AclWI	GGATC	2 cut(s)	393, 665
AcsI	RAATTY	1 cut(s)	139
AfaI	GTAC	1 cut(s)	194
AfiI	CCNNNNNNNGG	2 cut(s)	217, 608
AgsI	TTSAA	1 cut(s)	241
AhlI	ACTAGT	1 cut(s)	556
AjnI	CCWGG	2 cut(s)	227, 655
AjuI	GAANNNNNNNTTGG	2 cut(s)	557, 589
AluBI	AGCT	2 cut(s)	18, 71
AluI	AGCT	2 cut(s)	18, 71
Alw21I	GWGCWC	1 cut(s)	531
AlwI	GGATC	2 cut(s)	393, 665
Ama87I	CYCGRG	1 cut(s)	196
AoxI	GGCC	1 cut(s)	331
ApeKI	GCWGC	1 cut(s)	692
ApoI	RAATTY	1 cut(s)	139
AseI	ATTAAT	1 cut(s)	500
AspS9I	GGNCC	1 cut(s)	4
AsuHPI	GGTGA	2 cut(s)	232, 711
AvaI	CYCGRG	1 cut(s)	196
AvaII	GGWCC	1 cut(s)	4
BbsI	GAAGAC	1 cut(s)	225
Bbv12I	GWGCWC	1 cut(s)	531
BbvI	GCAGC	1 cut(s)	704
BccI	CCATC	2 cut(s)	305, 724
BciT130I	CCWGG	2 cut(s)	229, 657
BcuI	ACTAGT	1 cut(s)	556
BfaI	CTAG	2 cut(s)	101, 557
BfmI	CTRYAG	1 cut(s)	327
BisI	GCNGC	3 cut(s)	360, 683, 693
BlsI	GCNGC	3 cut(s)	361, 684, 694
BmcAI	AGTACT	1 cut(s)	194
Bme1390I	CCNGG	2 cut(s)	229, 657
Bme18I	GGWCC	1 cut(s)	4
BmeT110I	CYCGRG	1 cut(s)	196
BmgT120I	GGNCC	1 cut(s)	4
BmiI	GGNNCC	1 cut(s)	6
BmrFI	CCNGG	2 cut(s)	229, 657
BmsI	GCATC	4 cut(s)	271, 346, 475, 491
BpiI	GAAGAC	1 cut(s)	225
BplI	GAGNNNNNCTC	2 cut(s)	179, 211
Bsc4I	CCNNNNNNNGG	2 cut(s)	217, 608
Bse1I	ACTGG	1 cut(s)	222
BseBI	CCWGG	2 cut(s)	229, 657
BseGI	GGATG	4 cut(s)	270, 466, 482, 514
BseLI	CCNNNNNNNGG	2 cut(s)	217, 608
BseMII	CTCAG	1 cut(s)	353
BseNI	ACTGG	1 cut(s)	222
BseRI	GAGGAG	1 cut(s)	662
BseXI	GCAGC	1 cut(s)	704
BseYI	CCCAGC	1 cut(s)	149
BsgI	GTGCAG	1 cut(s)	711
BshFI	GGCC	1 cut(s)	333
BsiHKAI	GWGCWC	1 cut(s)	531
BsiHKCI	CYCGRG	1 cut(s)	196
BslI	CCNNNNNNNGG	2 cut(s)	217, 608
BsmI	GAATGC	2 cut(s)	229, 423
BsnI	GGCC	1 cut(s)	333
BsoBI	CYCGRG	1 cut(s)	196
Bsp1286I	GDGCHC	1 cut(s)	531
Bsp143I	GATC	2 cut(s)	385, 670
BspACI	CCGC	4 cut(s)	185, 360, 674, 683
BspANI	GGCC	1 cut(s)	333
BspCNI	CTCAG	1 cut(s)	352
BspLI	GGNNCC	1 cut(s)	6
BspPI	GGATC	2 cut(s)	393, 665
BspQI	GCTCTTC	1 cut(s)	236
BsrI	ACTGG	1 cut(s)	222
BssMI	GATC	2 cut(s)	385, 670
Bst2UI	CCWGG	2 cut(s)	229, 657
Bst4CI	ACNGT	2 cut(s)	328, 588
Bst6I	CTCTTC	1 cut(s)	236
BstC8I	GCNNGC	2 cut(s)	20, 408
BstDEI	CTNAG	2 cut(s)	132, 339
BstF5I	GGATG	4 cut(s)	270, 466, 482, 514
BstKTI	GATC	2 cut(s)	388, 673
BstMBI	GATC	2 cut(s)	385, 670
BstMWI	GCNNNNNNNGC	4 cut(s)	77, 463, 619, 682
BstNI	CCWGG	2 cut(s)	229, 657
BstSCI	CCNGG	2 cut(s)	227, 655
BstSFI	CTRYAG	1 cut(s)	327
BstV1I	GCAGC	1 cut(s)	704
BstV2I	GAAGAC	1 cut(s)	225
BsuRI	GGCC	1 cut(s)	333
BtsCI	GGATG	4 cut(s)	270, 466, 482, 514
BtsI	GCAGTG	1 cut(s)	29
BtsIMutI	CAGTG	2 cut(s)	29, 215
Cac8I	GCNNGC	2 cut(s)	20, 408
Cfr13I	GGNCC	1 cut(s)	4
CsiI	ACCWGGT	1 cut(s)	655
Csp6I	GTAC	1 cut(s)	193
CviAII	CATG	3 cut(s)	335, 416, 618
CviJI	RGCY	8 cut(s)	18, 71, 93, 153, 304, 333, 410, 613
CviKI_1	RGCY	8 cut(s)	18, 71, 93, 153, 304, 333, 410, 613
CviQI	GTAC	1 cut(s)	193
DdeI	CTNAG	2 cut(s)	132, 339
DpnI	GATC	2 cut(s)	387, 672
DpnII	GATC	2 cut(s)	385, 670
Eam1104I	CTCTTC	1 cut(s)	236
EarI	CTCTTC	1 cut(s)	236
Eco32I	GATATC	2 cut(s)	256, 517
Eco47I	GGWCC	1 cut(s)	4
Eco88I	CYCGRG	1 cut(s)	196
EcoRII	CCWGG	2 cut(s)	227, 655
EcoRV	GATATC	2 cut(s)	256, 517
FaeI	CATG	3 cut(s)	338, 419, 621
FatI	CATG	3 cut(s)	334, 415, 617
Fnu4HI	GCNGC	3 cut(s)	360, 683, 693
FokI	GGATG	4 cut(s)	257, 453, 469, 521
Fsp4HI	GCNGC	3 cut(s)	360, 683, 693
FspBI	CTAG	2 cut(s)	101, 557
GluI	GCNGC	3 cut(s)	360, 683, 693
GsaI	CCCAGC	1 cut(s)	153
HaeIII	GGCC	1 cut(s)	333
Hin1II	CATG	3 cut(s)	338, 419, 621
HincII	GTYRAC	1 cut(s)	129
HindII	GTYRAC	1 cut(s)	129
HinfI	GANTC	1 cut(s)	82
HpaI	GTTAAC	1 cut(s)	129
HphI	GGTGA	2 cut(s)	232, 711
Hpy166II	GTNNAC	1 cut(s)	129
Hpy188I	TCNGA	2 cut(s)	342, 429
Hpy188III	TCNNGA	1 cut(s)	470
Hpy8I	GTNNAC	1 cut(s)	129
HpyCH4III	ACNGT	2 cut(s)	328, 588
HpyCH4V	TGCA	5 cut(s)	22, 284, 466, 539, 692
HpyF10VI	GCNNNNNNNGC	4 cut(s)	77, 463, 619, 682
HpyF3I	CTNAG	2 cut(s)	132, 339
Hsp92II	CATG	3 cut(s)	338, 419, 621
KspAI	GTTAAC	1 cut(s)	129
Kzo9I	GATC	2 cut(s)	385, 670
LguI	GCTCTTC	1 cut(s)	236
LmnI	GCTCC	1 cut(s)	526
Lsp1109I	GCAGC	1 cut(s)	704
LweI	GCATC	4 cut(s)	271, 346, 475, 491
MabI	ACCWGGT	1 cut(s)	655
MaeI	CTAG	2 cut(s)	101, 557
MaeIII	GTNAC	2 cut(s)	316, 700
MalI	GATC	2 cut(s)	387, 672
MboI	GATC	2 cut(s)	385, 670
MboII	GAAGA	3 cut(s)	153, 225, 253
MhlI	GDGCHC	1 cut(s)	531
MluCI	AATT	2 cut(s)	139, 501
MmeI	TCCRAC	2 cut(s)	140, 555
MnlI	CCTC	7 cut(s)	48, 388, 505, 535, 630, 640, 733
MseI	TTAA	5 cut(s)	128, 293, 366, 500, 534
MslI	CAYNNNNRTG	1 cut(s)	534
MspR9I	CCNGG	2 cut(s)	229, 657
Mva1269I	GAATGC	2 cut(s)	229, 423
MvaI	CCWGG	2 cut(s)	229, 657
MwoI	GCNNNNNNNGC	4 cut(s)	77, 463, 619, 682
NdeII	GATC	2 cut(s)	385, 670
NlaIII	CATG	3 cut(s)	338, 419, 621
NlaIV	GGNNCC	1 cut(s)	6
PciSI	GCTCTTC	1 cut(s)	236
PctI	GAATGC	2 cut(s)	229, 423
PfeI	GAWTC	1 cut(s)	82
PflMI	CCANNNNNTGG	2 cut(s)	217, 608
PkrI	GCNGC	3 cut(s)	361, 684, 694
PshBI	ATTAAT	1 cut(s)	500
Psp6I	CCWGG	2 cut(s)	227, 655
PspFI	CCCAGC	1 cut(s)	149
PspGI	CCWGG	2 cut(s)	227, 655
PspN4I	GGNNCC	1 cut(s)	6
PspPI	GGNCC	1 cut(s)	4
PsrI	GAACNNNNNNTAC	2 cut(s)	185, 217
RsaI	GTAC	1 cut(s)	194
RsaNI	GTAC	1 cut(s)	193
RseI	CAYNNNNRTG	1 cut(s)	534
SapI	GCTCTTC	1 cut(s)	236
SaqAI	TTAA	5 cut(s)	128, 293, 366, 500, 534
SatI	GCNGC	3 cut(s)	360, 683, 693
Sau3AI	GATC	2 cut(s)	385, 670
Sau96I	GGNCC	1 cut(s)	4
ScaI	AGTACT	1 cut(s)	194
ScrFI	CCNGG	2 cut(s)	229, 657
SduI	GDGCHC	1 cut(s)	531
SetI	ASST	5 cut(s)	20, 59, 73, 323, 658
SexAI	ACCWGGT	1 cut(s)	655
SfaNI	GCATC	4 cut(s)	271, 346, 475, 491
SfcI	CTRYAG	1 cut(s)	327
SinI	GGWCC	1 cut(s)	4
SmiMI	CAYNNNNRTG	1 cut(s)	534
SpeI	ACTAGT	1 cut(s)	556
Sse9I	AATT	2 cut(s)	139, 501
SsiI	CCGC	4 cut(s)	185, 360, 674, 683
SspMI	CTAG	2 cut(s)	101, 557
StyD4I	CCNGG	2 cut(s)	227, 655
TaaI	ACNGT	2 cut(s)	328, 588
TasI	AATT	2 cut(s)	139, 501
TatI	WGTACW	1 cut(s)	192
TauI	GCSGC	2 cut(s)	362, 685
TfiI	GAWTC	1 cut(s)	82
Tru1I	TTAA	5 cut(s)	128, 293, 366, 500, 534
Tru9I	TTAA	5 cut(s)	128, 293, 366, 500, 534
TscAI	CASTG	2 cut(s)	29, 222
TseI	GCWGC	1 cut(s)	692
TspDTI	ATGAA	3 cut(s)	152, 165, 504
TspRI	CASTG	2 cut(s)	29, 222
Van91I	CCANNNNNTGG	2 cut(s)	217, 608
VpaK11BI	GGWCC	1 cut(s)	4
VspI	ATTAAT	1 cut(s)	500
XapI	RAATTY	1 cut(s)	139
XspI	CTAG	2 cut(s)	101, 557
ZrmI	AGTACT	1 cut(s)	194

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.