Rmu_co8522155.1_g000002

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8522155.1
Physical Location & Seq
Forward (+)
1013 .. 2022
1010 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8522155.1_g000002.1.cds

Sequence Viewer

Length: 876 bp
atgatcagtgcctacgttcatatgtcagatatggaagaggcatacaagctctttcgggaaatgccaaatcgtgatactctgtcatggaattcaatgatcttagggtatgcccaggttggatatgaagaaaatgagaacttcataggagcagttaagctctttgctcagatgcaactcaaaggagagaaacctgatagacacactttatcttcagttcttgatttgccaataaacaatgcccttataactatgtattcacgatgtggtgcgatagaggaggcacaaccaatttttgatgagatgaaatgggagaaaaatgtcatctcgtggaatgcaatgatcggatgctacgcatctcatggttttgctgcagaggctttagagcttttcgctttgatgaagaggtttaaggtgccacctacttatataacatttattgcactgttgaatgcgtgtgctcatgcaggattagctgaagaagggcggaggcaatttaattccatgattagtgactttggtattgagccacgaattgaacagtatgcatcccttgtggacataattggttggcatggacagcttgaggaggctatggatttgatcaatagcatgtcatttgaatttgaagcagataagcctgtgtggggagcattgttaggtgcctgtagagtgcataacaatgcagagttggcaaaagttgcagctgaagcattaatgagacttgaatccgaatgctcagctccatatgtattgttatacaatatgtatgctgatgctgggcaatgtgatgaagcagcagctgtgagactgctgatggataataacaagataattaagcaaaaaggctatagtcaggtagatttttcccagtgctga

Protein Analysis

291

Amino Acids

32.78

Weight (kDa)

4.84

Isoelectric Point (pI)

39.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 245
AccB1I GGYRCC 2 cut(s) 412, 659
AciI CCGC 1 cut(s) 484
AcsI RAATTY 2 cut(s) 88, 620
AcuI CTGAAG 3 cut(s) 195, 495, 726
AdeI CACNNNGTG 1 cut(s) 263
AfiI CCNNNNNNNGG 1 cut(s) 644
AgsI TTSAA 6 cut(s) 93, 448, 536, 620, 626, 725
AjnI CCWGG 1 cut(s) 111
AluBI AGCT 8 cut(s) 49, 157, 385, 473, 580, 704, 740, 800
AluI AGCT 8 cut(s) 49, 157, 385, 473, 580, 704, 740, 800
Alw21I GWGCWC 1 cut(s) 460
Alw26I GTCTC 2 cut(s) 712, 799
AlwNI CAGNNNCTG 1 cut(s) 800
ApeKI GCWGC 4 cut(s) 368, 701, 794, 797
ApoI RAATTY 2 cut(s) 88, 620
AseI ATTAAT 1 cut(s) 713
BanI GGYRCC 2 cut(s) 412, 659
BauI CACGAG 1 cut(s) 325
Bbv12I GWGCWC 1 cut(s) 460
BbvI GCAGC 4 cut(s) 355, 713, 806, 809
BccI CCATC 1 cut(s) 808
BciT130I CCWGG 1 cut(s) 113
BclI TGATCA 2 cut(s) 3, 600
BcoDI GTCTC 2 cut(s) 712, 799
BfmI CTRYAG 3 cut(s) 369, 664, 847
BisI GCNGC 4 cut(s) 369, 702, 795, 798
BlpI GCTNAGC 1 cut(s) 736
BlsI GCNGC 4 cut(s) 370, 703, 796, 799
Bme1390I CCNGG 1 cut(s) 113
BmiI GGNNCC 2 cut(s) 414, 661
BmrFI CCNGG 1 cut(s) 113
BmrI ACTGGG 1 cut(s) 862
BmsI GCATC 5 cut(s) 159, 335, 362, 554, 763
BmuI ACTGGG 1 cut(s) 862
Bpu1102I GCTNAGC 1 cut(s) 736
BpuEI CTTGAG 1 cut(s) 602
BsaJI CCNNGG 1 cut(s) 111
Bsc4I CCNNNNNNNGG 1 cut(s) 644
Bse1I ACTGG 1 cut(s) 868
Bse3DI GCAATG 2 cut(s) 342, 788
BseBI CCWGG 1 cut(s) 113
BseDI CCNNGG 1 cut(s) 111
BseGI GGATG 2 cut(s) 350, 545
BseLI CCNNNNNNNGG 1 cut(s) 644
BseMI GCAATG 2 cut(s) 342, 788
BseMII CTCAG 2 cut(s) 179, 750
BseNI ACTGG 1 cut(s) 868
BseRI GAGGAG 2 cut(s) 290, 599
BseXI GCAGC 4 cut(s) 355, 713, 806, 809
BseYI CCCAGC 1 cut(s) 776
BshNI GGYRCC 2 cut(s) 412, 659
BsiHKAI GWGCWC 1 cut(s) 460
BslI CCNNNNNNNGG 1 cut(s) 644
BsmAI GTCTC 2 cut(s) 712, 799
BsmI GAATGC 3 cut(s) 337, 454, 737
Bsp1286I GDGCHC 1 cut(s) 460
Bsp143I GATC 4 cut(s) 3, 96, 339, 600
Bsp1720I GCTNAGC 1 cut(s) 736
BspACI CCGC 1 cut(s) 484
BspCNI CTCAG 2 cut(s) 178, 749
BspLI GGNNCC 2 cut(s) 414, 661
BspMAI CTGCAG 1 cut(s) 373
BspT107I GGYRCC 2 cut(s) 412, 659
BsrDI GCAATG 2 cut(s) 342, 788
BsrI ACTGG 1 cut(s) 868
BssECI CCNNGG 1 cut(s) 111
BssMI GATC 4 cut(s) 3, 96, 339, 600
BssSI CACGAG 1 cut(s) 325
Bst2BI CACGAG 1 cut(s) 325
Bst2UI CCWGG 1 cut(s) 113
Bst4CI ACNGT 2 cut(s) 444, 540
Bst6I CTCTTC 2 cut(s) 30, 395
BstAPI GCANNNNNTGC 1 cut(s) 698
BstDEI CTNAG 3 cut(s) 100, 165, 736
BstF5I GGATG 2 cut(s) 350, 545
BstKTI GATC 4 cut(s) 6, 99, 342, 603
BstMAI GTCTC 2 cut(s) 712, 799
BstMBI GATC 4 cut(s) 3, 96, 339, 600
BstMWI GCNNNNNNNGC 6 cut(s) 374, 470, 577, 689, 698, 707
BstNI CCWGG 1 cut(s) 113
BstNSI RCATGY 1 cut(s) 613
BstSCI CCNGG 1 cut(s) 111
BstSFI CTRYAG 3 cut(s) 369, 664, 847
BstV1I GCAGC 4 cut(s) 355, 713, 806, 809
BtsCI GGATG 2 cut(s) 350, 545
BtsIMutI CAGTG 3 cut(s) 13, 440, 875
CaiI CAGNNNCTG 1 cut(s) 800
CviAII CATG 6 cut(s) 84, 359, 461, 502, 572, 610
DdeI CTNAG 3 cut(s) 100, 165, 736
DpnI GATC 4 cut(s) 5, 98, 341, 602
DpnII GATC 4 cut(s) 3, 96, 339, 600
DraIII CACNNNGTG 1 cut(s) 263
Eam1104I CTCTTC 2 cut(s) 30, 395
EarI CTCTTC 2 cut(s) 30, 395
EciI GGCGGA 1 cut(s) 499
Eco57I CTGAAG 3 cut(s) 195, 495, 726
EcoRI GAATTC 1 cut(s) 88
EcoRII CCWGG 1 cut(s) 111
EcoT22I ATGCAT 1 cut(s) 547
FaeI CATG 6 cut(s) 87, 362, 464, 505, 575, 613
FatI CATG 6 cut(s) 83, 358, 460, 501, 571, 609
FauNDI CATATG 2 cut(s) 21, 745
FbaI TGATCA 2 cut(s) 3, 600
Fnu4HI GCNGC 4 cut(s) 369, 702, 795, 798
FokI GGATG 2 cut(s) 357, 532
Fsp4HI GCNGC 4 cut(s) 369, 702, 795, 798
GluI GCNGC 4 cut(s) 369, 702, 795, 798
GsaI CCCAGC 1 cut(s) 780
Hin1II CATG 6 cut(s) 87, 362, 464, 505, 575, 613
HinfI GANTC 1 cut(s) 725
Hpy166II GTNNAC 1 cut(s) 556
Hpy188I TCNGA 4 cut(s) 28, 168, 344, 730
Hpy188III TCNNGA 4 cut(s) 56, 71, 218, 258
Hpy8I GTNNAC 1 cut(s) 556
HpyAV CCTTC 1 cut(s) 473
HpyCH4III ACNGT 2 cut(s) 444, 540
HpyCH4IV ACGT 1 cut(s) 15
HpyCH4V TGCA 9 cut(s) 172, 335, 371, 440, 464, 545, 673, 683, 701
HpyF10VI GCNNNNNNNGC 6 cut(s) 374, 470, 577, 689, 698, 707
HpyF3I CTNAG 3 cut(s) 100, 165, 736
HpySE526I ACGT 1 cut(s) 15
Hsp92II CATG 6 cut(s) 87, 362, 464, 505, 575, 613
Ksp22I TGATCA 2 cut(s) 3, 600
Kzo9I GATC 4 cut(s) 3, 96, 339, 600
LmnI GCTCC 3 cut(s) 146, 647, 745
LpnPI CCDG 8 cut(s) 98, 125, 204, 450, 651, 676, 762, 839
Lsp1109I GCAGC 4 cut(s) 355, 713, 806, 809
LweI GCATC 5 cut(s) 159, 335, 362, 554, 763
MaeII ACGT 1 cut(s) 15
MaeIII GTNAC 1 cut(s) 509
MalI GATC 4 cut(s) 5, 98, 341, 602
MboI GATC 4 cut(s) 3, 96, 339, 600
MboII GAAGA 5 cut(s) 47, 137, 201, 412, 488
MhlI GDGCHC 1 cut(s) 460
MluCI AATT 8 cut(s) 88, 288, 491, 496, 531, 561, 620, 831
MmeI TCCRAC 1 cut(s) 97
MnlI CCTC 8 cut(s) 31, 268, 271, 367, 396, 480, 577, 580
Mph1103I ATGCAT 1 cut(s) 547
MseI TTAA 5 cut(s) 153, 408, 495, 713, 834
MslI CAYNNNNRTG 1 cut(s) 678
MspA1I CMGCKG 2 cut(s) 704, 800
MspR9I CCNGG 1 cut(s) 113
Mva1269I GAATGC 3 cut(s) 337, 454, 737
MvaI CCWGG 1 cut(s) 113
MwoI GCNNNNNNNGC 6 cut(s) 374, 470, 577, 689, 698, 707
NdeI CATATG 2 cut(s) 21, 745
NdeII GATC 4 cut(s) 3, 96, 339, 600
NlaIII CATG 6 cut(s) 87, 362, 464, 505, 575, 613
NlaIV GGNNCC 2 cut(s) 414, 661
NmuCI GTSAC 1 cut(s) 509
NsiI ATGCAT 1 cut(s) 547
NspI RCATGY 1 cut(s) 613
PctI GAATGC 3 cut(s) 337, 454, 737
PfeI GAWTC 1 cut(s) 725
PkrI GCNGC 4 cut(s) 370, 703, 796, 799
PshBI ATTAAT 1 cut(s) 713
PsiI TTATAA 1 cut(s) 245
Psp6I CCWGG 1 cut(s) 111
PspFI CCCAGC 1 cut(s) 776
PspGI CCWGG 1 cut(s) 111
PspN4I GGNNCC 2 cut(s) 414, 661
PstI CTGCAG 1 cut(s) 373
PstNI CAGNNNCTG 1 cut(s) 800
PvuII CAGCTG 2 cut(s) 704, 800
RseI CAYNNNNRTG 1 cut(s) 678
SaqAI TTAA 5 cut(s) 153, 408, 495, 713, 834
SatI GCNGC 4 cut(s) 369, 702, 795, 798
Sau3AI GATC 4 cut(s) 3, 96, 339, 600
ScrFI CCNGG 1 cut(s) 113
SduI GDGCHC 1 cut(s) 460
SfaNI GCATC 5 cut(s) 159, 335, 362, 554, 763
SfcI CTRYAG 3 cut(s) 369, 664, 847
SmiMI CAYNNNNRTG 1 cut(s) 678
SmlI CTYRAG 1 cut(s) 581
SmoI CTYRAG 1 cut(s) 581
Sse9I AATT 8 cut(s) 88, 288, 491, 496, 531, 561, 620, 831
SsiI CCGC 1 cut(s) 484
StyD4I CCNGG 1 cut(s) 111
TaaI ACNGT 2 cut(s) 444, 540
TaiI ACGT 1 cut(s) 18
TasI AATT 8 cut(s) 88, 288, 491, 496, 531, 561, 620, 831
TfiI GAWTC 1 cut(s) 725
Tru1I TTAA 5 cut(s) 153, 408, 495, 713, 834
Tru9I TTAA 5 cut(s) 153, 408, 495, 713, 834
TscAI CASTG 3 cut(s) 13, 447, 875
TseFI GTSAC 1 cut(s) 509
TseI GCWGC 4 cut(s) 368, 701, 794, 797
Tsp45I GTSAC 1 cut(s) 509
TspDTI ATGAA 6 cut(s) 8, 130, 138, 317, 413, 804
TspRI CASTG 3 cut(s) 13, 447, 875
VspI ATTAAT 1 cut(s) 713
XapI RAATTY 2 cut(s) 88, 620
XceI RCATGY 1 cut(s) 613
Zsp2I ATGCAT 1 cut(s) 547
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.