Rmu_sc0000502.1_g000018

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000502.1
Physical Location & Seq
Reverse (-)
78083 .. 78388
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000502.1_g000018.1.cds

Sequence Viewer

Length: 306 bp
atggcttccctagaactggacagccttcccttcggagaccatacgtactccgcctcgacgatcactctctcacggtactttccagctgaacgcctcgtctcgctcaacaactcggaggccccaatttacgccgacgggttgttgatcatcctagcactagcaggttcttcgaccggtatcgggttcgattgggagcttcagccccaagctgcttggtgccgtgaaaccctaagaagaagaagaagaaaatcccagaagaagaagaagaaggaagaaaaagaaatgaaaagaaaaggaaaaaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

11.52

Weight (kDa)

9.88

Isoelectric Point (pI)

68.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 152
AccB1I GGYRCC 1 cut(s) 216
AciI CCGC 1 cut(s) 51
AcuI CTGAAG 1 cut(s) 182
AfaI GTAC 2 cut(s) 47, 77
AfiI CCNNNNNNNGG 2 cut(s) 16, 180
AgeI ACCGGT 1 cut(s) 173
AluBI AGCT 3 cut(s) 86, 196, 209
AluI AGCT 3 cut(s) 86, 196, 209
Alw26I GTCTC 2 cut(s) 30, 103
AoxI GGCC 1 cut(s) 117
ApeKI GCWGC 1 cut(s) 209
AsiGI ACCGGT 1 cut(s) 173
AspS9I GGNCC 1 cut(s) 118
BanI GGYRCC 1 cut(s) 216
BbvI GCAGC 1 cut(s) 196
BceAI ACGGC 1 cut(s) 204
BcgI CGANNNNNNTGC 2 cut(s) 150, 184
BclI TGATCA 1 cut(s) 144
BcoDI GTCTC 2 cut(s) 30, 103
BfaI CTAG 3 cut(s) 11, 152, 158
BfuAI ACCTGC 1 cut(s) 152
BisI GCNGC 1 cut(s) 210
BlsI GCNGC 1 cut(s) 211
BmgT120I GGNCC 1 cut(s) 118
BmiI GGNNCC 2 cut(s) 120, 218
BsaAI YACGTR 1 cut(s) 45
BsaI GGTCTC 1 cut(s) 30
BsaWI WCCGGW 1 cut(s) 173
Bsc4I CCNNNNNNNGG 2 cut(s) 16, 180
Bse118I RCCGGY 1 cut(s) 173
Bse1I ACTGG 1 cut(s) 21
BseGI GGATG 1 cut(s) 147
BseLI CCNNNNNNNGG 2 cut(s) 16, 180
BseNI ACTGG 1 cut(s) 21
BseXI GCAGC 1 cut(s) 196
Bsh1285I CGRYCG 1 cut(s) 174
BshFI GGCC 1 cut(s) 119
BshNI GGYRCC 1 cut(s) 216
BshTI ACCGGT 1 cut(s) 173
BsiEI CGRYCG 1 cut(s) 174
BsiSI CCGG 1 cut(s) 174
BslI CCNNNNNNNGG 2 cut(s) 16, 180
BsmAI GTCTC 2 cut(s) 30, 103
BsmBI CGTCTC 1 cut(s) 103
BsnI GGCC 1 cut(s) 119
Bso31I GGTCTC 1 cut(s) 30
Bsp143I GATC 2 cut(s) 60, 144
BspACI CCGC 1 cut(s) 51
BspANI GGCC 1 cut(s) 119
BspLI GGNNCC 2 cut(s) 120, 218
BspMI ACCTGC 1 cut(s) 152
BspT107I GGYRCC 1 cut(s) 216
BspTNI GGTCTC 1 cut(s) 30
BsrFI RCCGGY 1 cut(s) 173
BsrI ACTGG 1 cut(s) 21
BssAI RCCGGY 1 cut(s) 173
BssMI GATC 2 cut(s) 60, 144
Bst4CI ACNGT 1 cut(s) 75
BstBAI YACGTR 1 cut(s) 45
BstDEI CTNAG 1 cut(s) 230
BstF5I GGATG 1 cut(s) 147
BstKTI GATC 2 cut(s) 63, 147
BstMAI GTCTC 2 cut(s) 30, 103
BstMBI GATC 2 cut(s) 60, 144
BstMCI CGRYCG 1 cut(s) 174
BstSNI TACGTA 1 cut(s) 45
BstV1I GCAGC 1 cut(s) 196
BsuRI GGCC 1 cut(s) 119
BtsCI GGATG 1 cut(s) 147
BveI ACCTGC 1 cut(s) 152
Cfr10I RCCGGY 1 cut(s) 173
Cfr13I GGNCC 1 cut(s) 118
Csp6I GTAC 2 cut(s) 46, 76
CspAI ACCGGT 1 cut(s) 173
CviJI RGCY 7 cut(s) 5, 24, 86, 119, 196, 202, 209
CviKI_1 RGCY 7 cut(s) 5, 24, 86, 119, 196, 202, 209
CviQI GTAC 2 cut(s) 46, 76
DdeI CTNAG 1 cut(s) 230
DpnI GATC 2 cut(s) 62, 146
DpnII GATC 2 cut(s) 60, 144
EciI GGCGGA 1 cut(s) 40
Eco105I TACGTA 1 cut(s) 45
Eco31I GGTCTC 1 cut(s) 30
Eco57I CTGAAG 1 cut(s) 182
EcoO109I RGGNCCY 1 cut(s) 118
Esp3I CGTCTC 1 cut(s) 103
FaiI YATR 1 cut(s) 42
FbaI TGATCA 1 cut(s) 144
Fnu4HI GCNGC 1 cut(s) 210
FokI GGATG 1 cut(s) 134
Fsp4HI GCNGC 1 cut(s) 210
FspBI CTAG 3 cut(s) 11, 152, 158
GluI GCNGC 1 cut(s) 210
HaeIII GGCC 1 cut(s) 119
HapII CCGG 1 cut(s) 174
HpaII CCGG 1 cut(s) 174
Hpy188I TCNGA 2 cut(s) 35, 115
Hpy99I CGWCG 2 cut(s) 61, 137
HpyAV CCTTC 3 cut(s) 35, 40, 262
HpyCH4III ACNGT 1 cut(s) 75
HpyCH4IV ACGT 1 cut(s) 44
HpyF3I CTNAG 1 cut(s) 230
HpySE526I ACGT 1 cut(s) 44
Ksp22I TGATCA 1 cut(s) 144
Kzo9I GATC 2 cut(s) 60, 144
LmnI GCTCC 1 cut(s) 193
LpnPI CCDG 5 cut(s) 2, 96, 147, 187, 266
Lsp1109I GCAGC 1 cut(s) 196
MaeI CTAG 3 cut(s) 11, 152, 158
MaeII ACGT 1 cut(s) 44
MalI GATC 2 cut(s) 62, 146
MboI GATC 2 cut(s) 60, 144
MluCI AATT 1 cut(s) 123
MnlI CCTC 3 cut(s) 64, 104, 109
MspA1I CMGCKG 1 cut(s) 86
MspI CCGG 1 cut(s) 174
NdeII GATC 2 cut(s) 60, 144
NlaIV GGNNCC 2 cut(s) 120, 218
PinAI ACCGGT 1 cut(s) 173
PkrI GCNGC 1 cut(s) 211
Ppu21I YACGTR 1 cut(s) 45
PspN4I GGNNCC 2 cut(s) 120, 218
PspPI GGNCC 1 cut(s) 118
PvuII CAGCTG 1 cut(s) 86
RsaI GTAC 2 cut(s) 47, 77
RsaNI GTAC 2 cut(s) 46, 76
SatI GCNGC 1 cut(s) 210
Sau3AI GATC 2 cut(s) 60, 144
Sau96I GGNCC 1 cut(s) 118
SetI ASST 5 cut(s) 47, 88, 166, 198, 211
SnaBI TACGTA 1 cut(s) 45
Sse9I AATT 1 cut(s) 123
SsiI CCGC 1 cut(s) 51
SspMI CTAG 3 cut(s) 11, 152, 158
TaaI ACNGT 1 cut(s) 75
TaiI ACGT 1 cut(s) 47
TaqI TCGA 3 cut(s) 56, 170, 186
TasI AATT 1 cut(s) 123
TseI GCWGC 1 cut(s) 209
TspDTI ATGAA 1 cut(s) 299
XspI CTAG 3 cut(s) 11, 152, 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.