Rmu_sc0002831.1_g000015

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002831.1
Physical Location & Seq
Forward (+)
53112 .. 53414
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002831.1_g000015.1.cds

Sequence Viewer

Length: 303 bp
atggcttccctagaattggacagccttccctttggagaccttacgtactccgcctcgacgaccactctctcacggtacattatggctgaacgcctcgtctcgctcaacaacttggcggccccaatttacgtcgatgggtcgttgatcatcccagcaccaataggttcttcgactggtattaggttcgattgggagcttcagccccaagctgcttggtgccgtgaaaccctaagaagaagaagaagaaaatcccagaagaaaaagaaggaagaaaaagaaatgaaaagaaaagaaaaaaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.5

Weight (kDa)

9.94

Isoelectric Point (pI)

65.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 216
AciI CCGC 2 cut(s) 51, 116
AcuI CTGAAG 1 cut(s) 182
AfaI GTAC 2 cut(s) 47, 77
AfiI CCNNNNNNNGG 1 cut(s) 16
AjuI GAANNNNNNNTTGG 2 cut(s) 151, 183
AluBI AGCT 2 cut(s) 196, 209
AluI AGCT 2 cut(s) 196, 209
Alw26I GTCTC 2 cut(s) 30, 103
AoxI GGCC 1 cut(s) 117
ApeKI GCWGC 1 cut(s) 209
AspS9I GGNCC 1 cut(s) 118
BanI GGYRCC 1 cut(s) 216
BbvI GCAGC 1 cut(s) 196
BccI CCATC 1 cut(s) 128
BceAI ACGGC 1 cut(s) 204
BclI TGATCA 1 cut(s) 144
BcoDI GTCTC 2 cut(s) 30, 103
BfaI CTAG 1 cut(s) 11
BisI GCNGC 2 cut(s) 117, 210
BlsI GCNGC 2 cut(s) 118, 211
BmgT120I GGNCC 1 cut(s) 118
BmiI GGNNCC 2 cut(s) 120, 218
BsaAI YACGTR 1 cut(s) 45
BsaI GGTCTC 1 cut(s) 30
Bsc4I CCNNNNNNNGG 1 cut(s) 16
Bse1I ACTGG 1 cut(s) 178
BseGI GGATG 1 cut(s) 147
BseLI CCNNNNNNNGG 1 cut(s) 16
BseNI ACTGG 1 cut(s) 178
BseXI GCAGC 1 cut(s) 196
BseYI CCCAGC 1 cut(s) 151
BshFI GGCC 1 cut(s) 119
BshNI GGYRCC 1 cut(s) 216
BslI CCNNNNNNNGG 1 cut(s) 16
BsmAI GTCTC 2 cut(s) 30, 103
BsmBI CGTCTC 1 cut(s) 103
BsnI GGCC 1 cut(s) 119
Bso31I GGTCTC 1 cut(s) 30
Bsp143I GATC 1 cut(s) 144
BspACI CCGC 2 cut(s) 51, 116
BspANI GGCC 1 cut(s) 119
BspLI GGNNCC 2 cut(s) 120, 218
BspT107I GGYRCC 1 cut(s) 216
BspTNI GGTCTC 1 cut(s) 30
BsrI ACTGG 1 cut(s) 178
BssMI GATC 1 cut(s) 144
Bst4CI ACNGT 1 cut(s) 75
BstBAI YACGTR 1 cut(s) 45
BstDEI CTNAG 1 cut(s) 230
BstF5I GGATG 1 cut(s) 147
BstKTI GATC 1 cut(s) 147
BstMAI GTCTC 2 cut(s) 30, 103
BstMBI GATC 1 cut(s) 144
BstSNI TACGTA 1 cut(s) 45
BstV1I GCAGC 1 cut(s) 196
BsuRI GGCC 1 cut(s) 119
BtsCI GGATG 1 cut(s) 147
Cfr13I GGNCC 1 cut(s) 118
Csp6I GTAC 2 cut(s) 46, 76
CviJI RGCY 7 cut(s) 5, 24, 86, 119, 196, 202, 209
CviKI_1 RGCY 7 cut(s) 5, 24, 86, 119, 196, 202, 209
CviQI GTAC 2 cut(s) 46, 76
DdeI CTNAG 1 cut(s) 230
DpnI GATC 1 cut(s) 146
DpnII GATC 1 cut(s) 144
EciI GGCGGA 1 cut(s) 40
Eco105I TACGTA 1 cut(s) 45
Eco31I GGTCTC 1 cut(s) 30
Eco57I CTGAAG 1 cut(s) 182
Esp3I CGTCTC 1 cut(s) 103
FaiI YATR 1 cut(s) 83
FbaI TGATCA 1 cut(s) 144
Fnu4HI GCNGC 2 cut(s) 117, 210
FokI GGATG 1 cut(s) 134
Fsp4HI GCNGC 2 cut(s) 117, 210
FspBI CTAG 1 cut(s) 11
GluI GCNGC 2 cut(s) 117, 210
GsaI CCCAGC 1 cut(s) 155
HaeIII GGCC 1 cut(s) 119
Hpy99I CGWCG 2 cut(s) 61, 134
HpyAV CCTTC 2 cut(s) 35, 259
HpyCH4III ACNGT 1 cut(s) 75
HpyCH4IV ACGT 2 cut(s) 44, 129
HpyF3I CTNAG 1 cut(s) 230
HpySE526I ACGT 2 cut(s) 44, 129
Ksp22I TGATCA 1 cut(s) 144
Kzo9I GATC 1 cut(s) 144
LmnI GCTCC 1 cut(s) 193
LpnPI CCDG 3 cut(s) 159, 165, 266
Lsp1109I GCAGC 1 cut(s) 196
MaeI CTAG 1 cut(s) 11
MaeII ACGT 2 cut(s) 44, 129
MalI GATC 1 cut(s) 146
MboI GATC 1 cut(s) 144
MboII GAAGA 7 cut(s) 159, 246, 249, 252, 255, 268, 281
MluCI AATT 2 cut(s) 14, 123
MnlI CCTC 2 cut(s) 64, 104
NdeII GATC 1 cut(s) 144
NlaIV GGNNCC 2 cut(s) 120, 218
PkrI GCNGC 2 cut(s) 118, 211
Ppu21I YACGTR 1 cut(s) 45
PspFI CCCAGC 1 cut(s) 151
PspN4I GGNNCC 2 cut(s) 120, 218
PspPI GGNCC 1 cut(s) 118
RsaI GTAC 2 cut(s) 47, 77
RsaNI GTAC 2 cut(s) 46, 76
SatI GCNGC 2 cut(s) 117, 210
Sau3AI GATC 1 cut(s) 144
Sau96I GGNCC 1 cut(s) 118
SetI ASST 7 cut(s) 42, 47, 132, 166, 185, 198, 211
SnaBI TACGTA 1 cut(s) 45
Sse9I AATT 2 cut(s) 14, 123
SsiI CCGC 2 cut(s) 51, 116
SspMI CTAG 1 cut(s) 11
TaaI ACNGT 1 cut(s) 75
TaiI ACGT 2 cut(s) 47, 132
TaqI TCGA 4 cut(s) 56, 132, 170, 186
TasI AATT 2 cut(s) 14, 123
TauI GCSGC 1 cut(s) 119
TseI GCWGC 1 cut(s) 209
TspDTI ATGAA 1 cut(s) 296
XspI CTAG 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.