Rmu_sc0000766.1_g000012

SelT-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000766.1
Physical Location & Seq
Reverse (-)
52186 .. 53999
1814 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000766.1_g000012.1.cds

Sequence Viewer

Length: 702 bp
atggatcgagctcagttagttctggttgcgttaccaatccttctgttctgcagagacattttcaaccttttcacacctagacctccaaaacctacccagtatcattatcaccagattgttgatcctgatgaaccagaccctgatccccaacccgaacagcaacagattctccaagagccgcttaaattcccagttcagaaatccgatggcattggagaaactggcataggaagcaccatcaacattgatttttgcacatcttgttcttacagaggaaatgcaataacaatgaaaaacatgctggcaacatcatatcctgggatcactgtaatcctagcaaaccatcctgcttcattttcaaaacgtctgctgagcaaattggtaccagttgttcaagtaggaatcatcgggacgatattgggtggtgagcaaatttttcaaaggttggggatggtgccaccaccttcttggtacgagtccttgaaagctaatagatttgggagtattgcaagcagttggcttttggggaacttcctccaatcctaccttcacagtacaggagcttttgaagtcttttgtaatggtgaattggtcttttcaaagctgaaggaggagagattccccagtgaaattgagttgagggatctggtcgggaagaagcttgctaatttgagaaaaactccaaaagctgatatcaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

233

Amino Acids

26.01

Weight (kDa)

8.3

Isoelectric Point (pI)

40.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 382
AccB1I GGYRCC 2 cut(s) 382, 454
AciI CCGC 1 cut(s) 179
AclWI GGATC 5 cut(s) 12, 116, 137, 329, 651
AcsI RAATTY 2 cut(s) 185, 432
AcuI CTGAAG 1 cut(s) 626
AfaI GTAC 3 cut(s) 384, 473, 556
AgsI TTSAA 7 cut(s) 64, 360, 395, 440, 484, 569, 600
AjnI CCWGG 1 cut(s) 316
AjuI GAANNNNNNNTTGG 2 cut(s) 531, 563
AluBI AGCT 6 cut(s) 11, 488, 563, 604, 661, 689
AluI AGCT 6 cut(s) 11, 488, 563, 604, 661, 689
Alw21I GWGCWC 1 cut(s) 13
Alw26I GTCTC 1 cut(s) 48
AlwI GGATC 5 cut(s) 12, 116, 137, 329, 651
AlwNI CAGNNNCTG 1 cut(s) 140
ApoI RAATTY 2 cut(s) 185, 432
Asp718I GGTACC 1 cut(s) 382
AsuHPI GGTGA 3 cut(s) 101, 437, 596
BanI GGYRCC 2 cut(s) 382, 454
BanII GRGCYC 1 cut(s) 13
Bbv12I GWGCWC 1 cut(s) 13
BccI CCATC 4 cut(s) 200, 245, 351, 445
BciT130I CCWGG 1 cut(s) 318
BcoDI GTCTC 1 cut(s) 48
BfaI CTAG 2 cut(s) 78, 335
BfmI CTRYAG 1 cut(s) 49
BisI GCNGC 1 cut(s) 179
BlpI GCTNAGC 1 cut(s) 371
BlsI GCNGC 1 cut(s) 180
Bme1390I CCNGG 1 cut(s) 318
BmiI GGNNCC 2 cut(s) 384, 456
BmrFI CCNGG 1 cut(s) 318
BmrI ACTGGG 3 cut(s) 91, 185, 618
BmuI ACTGGG 3 cut(s) 91, 185, 618
BplI GAGNNNNNCTC 2 cut(s) 664, 696
Bpu1102I GCTNAGC 1 cut(s) 371
BsaJI CCNNGG 1 cut(s) 317
BsaXI ACNNNNNCTCC 2 cut(s) 153, 183
Bse1I ACTGG 5 cut(s) 97, 191, 226, 386, 624
BseBI CCWGG 1 cut(s) 318
BseDI CCNNGG 1 cut(s) 317
BseGI GGATG 2 cut(s) 343, 456
BseMII CTCAG 2 cut(s) 26, 362
BseNI ACTGG 5 cut(s) 97, 191, 226, 386, 624
BseRI GAGGAG 1 cut(s) 626
BshNI GGYRCC 2 cut(s) 382, 454
BsiHKAI GWGCWC 1 cut(s) 13
BslFI GGGAC 1 cut(s) 424
BsmAI GTCTC 1 cut(s) 48
BsmFI GGGAC 1 cut(s) 424
Bsp1286I GDGCHC 1 cut(s) 13
Bsp143I GATC 5 cut(s) 4, 121, 142, 321, 643
Bsp1720I GCTNAGC 1 cut(s) 371
BspACI CCGC 1 cut(s) 179
BspCNI CTCAG 2 cut(s) 25, 363
BspLI GGNNCC 2 cut(s) 384, 456
BspMAI CTGCAG 1 cut(s) 53
BspPI GGATC 5 cut(s) 12, 116, 137, 329, 651
BspT107I GGYRCC 2 cut(s) 382, 454
BsrI ACTGG 5 cut(s) 97, 191, 226, 386, 624
BssECI CCNNGG 1 cut(s) 317
BssMI GATC 5 cut(s) 4, 121, 142, 321, 643
Bst2UI CCWGG 1 cut(s) 318
Bst4CI ACNGT 2 cut(s) 328, 554
BstC8I GCNNGC 3 cut(s) 303, 511, 663
BstDEI CTNAG 2 cut(s) 12, 371
BstF5I GGATG 2 cut(s) 343, 456
BstKTI GATC 5 cut(s) 7, 124, 145, 324, 646
BstMAI GTCTC 1 cut(s) 48
BstMBI GATC 5 cut(s) 4, 121, 142, 321, 643
BstMWI GCNNNNNNNGC 1 cut(s) 231
BstNI CCWGG 1 cut(s) 318
BstNSI RCATGY 1 cut(s) 301
BstSCI CCNGG 1 cut(s) 316
BstSFI CTRYAG 1 cut(s) 49
BstX2I RGATCY 1 cut(s) 643
BstXI CCANNNNNNTGG 1 cut(s) 468
BstYI RGATCY 1 cut(s) 643
BtsCI GGATG 2 cut(s) 343, 456
BtsIMutI CAGTG 2 cut(s) 324, 631
Cac8I GCNNGC 3 cut(s) 303, 511, 663
CaiI CAGNNNCTG 1 cut(s) 140
Csp6I GTAC 3 cut(s) 383, 472, 555
CviAII CATG 1 cut(s) 298
CviJI RGCY 8 cut(s) 11, 178, 488, 520, 563, 604, 661, 689
CviKI_1 RGCY 8 cut(s) 11, 178, 488, 520, 563, 604, 661, 689
CviQI GTAC 3 cut(s) 383, 472, 555
DdeI CTNAG 2 cut(s) 12, 371
DpnI GATC 5 cut(s) 6, 123, 144, 323, 645
DpnII GATC 5 cut(s) 4, 121, 142, 321, 643
Ecl136II GAGCTC 1 cut(s) 11
Eco24I GRGCYC 1 cut(s) 13
Eco32I GATATC 1 cut(s) 694
Eco53kI GAGCTC 1 cut(s) 11
Eco57I CTGAAG 1 cut(s) 626
EcoICRI GAGCTC 1 cut(s) 11
EcoRII CCWGG 1 cut(s) 316
EcoRV GATATC 1 cut(s) 694
EcoT38I GRGCYC 1 cut(s) 13
FaeI CATG 1 cut(s) 301
FaiI YATR 3 cut(s) 227, 299, 313
FalI AAGNNNNNCTT 2 cut(s) 165, 197
FaqI GGGAC 1 cut(s) 424
FatI CATG 1 cut(s) 297
Fnu4HI GCNGC 1 cut(s) 179
FokI GGATG 2 cut(s) 330, 463
FriOI GRGCYC 1 cut(s) 13
Fsp4HI GCNGC 1 cut(s) 179
FspBI CTAG 2 cut(s) 78, 335
GluI GCNGC 1 cut(s) 179
Hin1II CATG 1 cut(s) 301
HindIII AAGCTT 1 cut(s) 659
HinfI GANTC 4 cut(s) 166, 402, 476, 618
HphI GGTGA 3 cut(s) 101, 437, 596
Hpy188I TCNGA 2 cut(s) 198, 205
Hpy188III TCNNGA 3 cut(s) 125, 409, 652
HpyAV CCTTC 4 cut(s) 50, 474, 557, 601
HpyCH4III ACNGT 2 cut(s) 328, 554
HpyCH4IV ACGT 1 cut(s) 364
HpyCH4V TGCA 4 cut(s) 51, 255, 281, 509
HpyF10VI GCNNNNNNNGC 1 cut(s) 231
HpyF3I CTNAG 2 cut(s) 12, 371
HpySE526I ACGT 1 cut(s) 364
Hsp92II CATG 1 cut(s) 301
KpnI GGTACC 1 cut(s) 386
Kzo9I GATC 5 cut(s) 4, 121, 142, 321, 643
LmnI GCTCC 1 cut(s) 560
MaeI CTAG 2 cut(s) 78, 335
MaeII ACGT 1 cut(s) 364
MaeIII GTNAC 1 cut(s) 30
MalI GATC 5 cut(s) 6, 123, 144, 323, 645
MboI GATC 5 cut(s) 4, 121, 142, 321, 643
MboII GAAGA 1 cut(s) 667
MflI RGATCY 1 cut(s) 643
MhlI GDGCHC 1 cut(s) 13
MluCI AATT 6 cut(s) 185, 377, 432, 587, 630, 667
MlyI GAGTC 1 cut(s) 485
MnlI CCTC 5 cut(s) 93, 266, 545, 604, 633
MseI TTAA 1 cut(s) 183
MspR9I CCNGG 1 cut(s) 318
MvaI CCWGG 1 cut(s) 318
MwoI GCNNNNNNNGC 1 cut(s) 231
NdeII GATC 5 cut(s) 4, 121, 142, 321, 643
NlaIII CATG 1 cut(s) 301
NlaIV GGNNCC 2 cut(s) 384, 456
NspI RCATGY 1 cut(s) 301
PfeI GAWTC 3 cut(s) 166, 402, 618
PkrI GCNGC 1 cut(s) 180
PleI GAGTC 1 cut(s) 484
PpsI GAGTC 1 cut(s) 484
Psp124BI GAGCTC 1 cut(s) 13
Psp6I CCWGG 1 cut(s) 316
PspGI CCWGG 1 cut(s) 316
PspN4I GGNNCC 2 cut(s) 384, 456
PsrI GAACNNNNNNTAC 2 cut(s) 375, 407
PstI CTGCAG 1 cut(s) 53
PstNI CAGNNNCTG 1 cut(s) 140
PsuI RGATCY 1 cut(s) 643
RsaI GTAC 3 cut(s) 384, 473, 556
RsaNI GTAC 3 cut(s) 383, 472, 555
SacI GAGCTC 1 cut(s) 13
SaqAI TTAA 1 cut(s) 183
SatI GCNGC 1 cut(s) 179
Sau3AI GATC 5 cut(s) 4, 121, 142, 321, 643
SchI GAGTC 1 cut(s) 485
ScrFI CCNGG 1 cut(s) 318
SduI GDGCHC 1 cut(s) 13
SfcI CTRYAG 1 cut(s) 49
Sse9I AATT 6 cut(s) 185, 377, 432, 587, 630, 667
SsiI CCGC 1 cut(s) 179
SspMI CTAG 2 cut(s) 78, 335
SstI GAGCTC 1 cut(s) 13
StyD4I CCNGG 1 cut(s) 316
TaaI ACNGT 2 cut(s) 328, 554
TaiI ACGT 1 cut(s) 367
TaqI TCGA 1 cut(s) 7
TasI AATT 6 cut(s) 185, 377, 432, 587, 630, 667
TatI WGTACW 1 cut(s) 554
TauI GCSGC 1 cut(s) 181
TfiI GAWTC 3 cut(s) 166, 402, 618
Tru1I TTAA 1 cut(s) 183
Tru9I TTAA 1 cut(s) 183
TscAI CASTG 2 cut(s) 331, 631
TspDTI ATGAA 3 cut(s) 144, 305, 342
TspRI CASTG 2 cut(s) 331, 631
XapI RAATTY 2 cut(s) 185, 432
XceI RCATGY 1 cut(s) 301
XcmI CCANNNNNNNNNTGG 1 cut(s) 465
XspI CTAG 2 cut(s) 78, 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.