Rorug05G0402100

Rdx family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
55262737 .. 55263732
996 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0402100.1

Sequence Viewer

Length: 291 bp
ATGGGGTTCCGCTTGCCTGGTATTGCTAATGCCAAAAGAAGTCTTACTAGATCTCTATCTGCTTCAAAGAGCTTAGATATCCCAAAAGGCTACTTTGCAGTCTATGTTGGGAAGAACCAGCAGAAAAAGCGATTTGTGATTCCTATATCATACTTGAACGAGCCTCTTTTCCTTGATTTGTTGAGTCAAGCTGAAGAAGAGTTTGGATATGATCATCCAATGGGTGGCATCACAATCCCATGCAGTGAACATACCTTCCTAAATCTCACTTCGCACTTAGTGAATGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

96

Amino Acids

10.76

Weight (kDa)

7.9

Isoelectric Point (pI)

35.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 17 - 92 2.1e-23 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 224
AciI CCGC 1 cut(s) 10
AcuI CTGAAG 1 cut(s) 213
AdeI CACNNNGTG 1 cut(s) 280
AfiI CCNNNNNNNGG 1 cut(s) 224
AgsI TTSAA 2 cut(s) 66, 157
AjnI CCWGG 1 cut(s) 16
AjuI GAANNNNNNNTTGG 2 cut(s) 186, 218
AloI GAACNNNNNNTCC 2 cut(s) 240, 272
AluBI AGCT 2 cut(s) 72, 191
AluI AGCT 2 cut(s) 72, 191
BciT130I CCWGG 1 cut(s) 18
BclI TGATCA 1 cut(s) 211
BfaI CTAG 1 cut(s) 48
BglII AGATCT 1 cut(s) 50
Bme1390I CCNGG 1 cut(s) 18
BmiI GGNNCC 1 cut(s) 8
BmrFI CCNGG 1 cut(s) 18
BmsI GCATC 1 cut(s) 237
BsaBI GATNNNNATC 1 cut(s) 55
Bsc4I CCNNNNNNNGG 1 cut(s) 224
Bse8I GATNNNNATC 1 cut(s) 55
BseBI CCWGG 1 cut(s) 18
BseGI GGATG 1 cut(s) 214
BseJI GATNNNNATC 1 cut(s) 55
BseLI CCNNNNNNNGG 1 cut(s) 224
BslI CCNNNNNNNGG 1 cut(s) 224
Bsp143I GATC 2 cut(s) 50, 211
BspACI CCGC 1 cut(s) 10
BspLI GGNNCC 1 cut(s) 8
BssMI GATC 2 cut(s) 50, 211
Bst2UI CCWGG 1 cut(s) 18
Bst6I CTCTTC 1 cut(s) 192
BstC8I GCNNGC 1 cut(s) 14
BstDEI CTNAG 2 cut(s) 73, 277
BstF5I GGATG 1 cut(s) 214
BstKTI GATC 2 cut(s) 53, 214
BstMBI GATC 2 cut(s) 50, 211
BstMWI GCNNNNNNNGC 1 cut(s) 127
BstNI CCWGG 1 cut(s) 18
BstSCI CCNGG 1 cut(s) 16
BstX2I RGATCY 1 cut(s) 50
BstYI RGATCY 1 cut(s) 50
BtsCI GGATG 1 cut(s) 214
BtsI GCAGTG 1 cut(s) 250
BtsIMutI CAGTG 1 cut(s) 250
Cac8I GCNNGC 1 cut(s) 14
CviAII CATG 1 cut(s) 240
CviJI RGCY 4 cut(s) 72, 90, 163, 191
CviKI_1 RGCY 4 cut(s) 72, 90, 163, 191
DdeI CTNAG 2 cut(s) 73, 277
DpnI GATC 2 cut(s) 52, 213
DpnII GATC 2 cut(s) 50, 211
DraIII CACNNNGTG 1 cut(s) 280
Eam1104I CTCTTC 1 cut(s) 192
EarI CTCTTC 1 cut(s) 192
Eco32I GATATC 1 cut(s) 79
Eco57I CTGAAG 1 cut(s) 213
EcoRII CCWGG 1 cut(s) 16
EcoRV GATATC 1 cut(s) 79
FaeI CATG 1 cut(s) 243
FaiI YATR 6 cut(s) 105, 146, 151, 210, 241, 252
FatI CATG 1 cut(s) 239
FbaI TGATCA 1 cut(s) 211
FokI GGATG 1 cut(s) 201
FspBI CTAG 1 cut(s) 48
Hin1II CATG 1 cut(s) 243
HinfI GANTC 2 cut(s) 139, 184
Hpy166II GTNNAC 1 cut(s) 248
Hpy8I GTNNAC 1 cut(s) 248
HpyAV CCTTC 1 cut(s) 265
HpyCH4V TGCA 2 cut(s) 98, 243
HpyF10VI GCNNNNNNNGC 1 cut(s) 127
HpyF3I CTNAG 2 cut(s) 73, 277
Hsp92II CATG 1 cut(s) 243
Ksp22I TGATCA 1 cut(s) 211
Kzo9I GATC 2 cut(s) 50, 211
LpnPI CCDG 3 cut(s) 3, 30, 131
LweI GCATC 1 cut(s) 237
MaeI CTAG 1 cut(s) 48
MalI GATC 2 cut(s) 52, 213
MboI GATC 2 cut(s) 50, 211
MboII GAAGA 3 cut(s) 124, 206, 209
MflI RGATCY 1 cut(s) 50
MlyI GAGTC 1 cut(s) 193
MnlI CCTC 1 cut(s) 174
MspR9I CCNGG 1 cut(s) 18
MvaI CCWGG 1 cut(s) 18
MwoI GCNNNNNNNGC 1 cut(s) 127
NdeII GATC 2 cut(s) 50, 211
NlaIII CATG 1 cut(s) 243
NlaIV GGNNCC 1 cut(s) 8
PfeI GAWTC 1 cut(s) 139
PflMI CCANNNNNTGG 1 cut(s) 224
PleI GAGTC 1 cut(s) 192
PpsI GAGTC 1 cut(s) 192
Psp6I CCWGG 1 cut(s) 16
PspGI CCWGG 1 cut(s) 16
PspN4I GGNNCC 1 cut(s) 8
PsuI RGATCY 1 cut(s) 50
Sau3AI GATC 2 cut(s) 50, 211
SchI GAGTC 1 cut(s) 193
ScrFI CCNGG 1 cut(s) 18
SetI ASST 3 cut(s) 74, 193, 257
SfaNI GCATC 1 cut(s) 237
SsiI CCGC 1 cut(s) 10
SspMI CTAG 1 cut(s) 48
StyD4I CCNGG 1 cut(s) 16
TfiI GAWTC 1 cut(s) 139
TscAI CASTG 1 cut(s) 250
TspRI CASTG 1 cut(s) 250
Van91I CCANNNNNTGG 1 cut(s) 224
XspI CTAG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.