Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000893.1

Orthogroup ID

OG0002279

Physical Location & Seq

Genomic Coordinates Forward (+)

1430 .. 3746

Gene Structure 2317 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000893.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 498 bp

atgttgcaatctaaaaacataacactatctttctcatcggagagttccattgaagaagaacttaagagagaaagcactgcagatgctattacaatattgataagctatcttgtgatgttcgcttatatttctcttactttgggtgactctcctcatttgtcttccttttacatttcatctaaggtattgctaggtctctctggagttgttcttgtcatgctctccattcttggatcagtggaatttttcagtgccattggagttaaatctaccgtaattattatggaagtcatcccatttcttgttctaccttcgcaaaattcttacgacggcaaatggtttgccgtggctaataatcttgcgacggcgcatttgccgtcgcaaataatattggcgatgccaccattcgcgttggaagcatcgccatcgcagagccgtcaccaatactcttttgcgacggcaaaaggggcttttgccacggcatggcgctgtggctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000323 GO:0003674 GO:0005488 GO:0005496 GO:0005575 GO:0005576 GO:0005622 GO:0005623 GO:0005634 GO:0005635 GO:0005737 GO:0005764 GO:0005773 GO:0005783 GO:0005886 GO:0005887 GO:0006082 GO:0006464 GO:0006486 GO:0006629 GO:0006807 GO:0006810 GO:0006869 GO:0007034 GO:0007041 GO:0008150 GO:0008152 GO:0008202 GO:0008206 GO:0008289 GO:0009058 GO:0009059 GO:0009100 GO:0009101 GO:0009987 GO:0010876 GO:0012505 GO:0015485 GO:0015850 GO:0015918 GO:0016020 GO:0016021 GO:0019538 GO:0019752 GO:0030301 GO:0031224 GO:0031226 GO:0031967 GO:0031975 GO:0032787 GO:0032934 GO:0033036 GO:0034645 GO:0036094 GO:0036211 GO:0042592 GO:0042632 GO:0043170 GO:0043178 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0043413 GO:0043436 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044281 GO:0044422 GO:0044424 GO:0044425 GO:0044428 GO:0044444 GO:0044446 GO:0044459 GO:0044464 GO:0048471 GO:0048878 GO:0051179 GO:0051234 GO:0055088 GO:0055092 GO:0065007 GO:0065008 GO:0070085 GO:0071702 GO:0071704 GO:0071944 GO:0097159 GO:1901135 GO:1901137 GO:1901360 GO:1901564 GO:1901566 GO:1901576 GO:1901615

KEGG Pathways

Metabolic & Signaling

ko04142 ko04979 map04142 map04979

Pfam Domains

Protein Families

NPC1_N Patched

Protein Analysis

165

Amino Acids

17.85

Weight (kDa)

5.86

Isoelectric Point (pI)

63.5

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002279)

Species	Orthologous Gene IDs
malus_domestica	MD00G1080500.v1.1 MD16G1285200.v1.1
rosa_chinensis	RchiOBHm_Chr2g0175261 RchiOBHm_Chr6g0280801
rosa_laevigata	RLG00000013082 RLG00000019605 RLG00000033344 RLG00000034484 RLG00000036984
rosa_multiflora	Rmu_sc0000893.1_g000002 Rmu_sc0002494.1_g000006 Rmu_sc0007139.1_g000001
rosa_roxburghii	Rroxscaffold_4G00312410 Rroxscaffold_7G00187620
rosa_rugosa	Rorug01G0060900 Rorug02G0158200 Rorug02G0250000 Rorug06G0134700
rosa_samantha	Rh1AG184800 Rh1AG199900 Rh1AG262300 Rh1BG097700 Rh1BG103100 Rh2CG636900 Rh2DG687600 Rh3CG050700 Rh3DG112000 Rh4CG020800 Rh4CG194300 Rh4DG079900 Rh5AG202600 Rh5BG321300 Rh5CG365700 Rh6AG170000 Rh6CG250600 Rh6DG242200 Rh6DG280400 Rh7AG279500 Rh7CG298700 Rh7CG343600 Rh7DG079500
rosa_wichuraiana	Rw4G014860 Rw6G026540

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	483
AccII	CGCG	1 cut(s)	410
AclWI	GGATC	1 cut(s)	241
AcsI	RAATTY	2 cut(s)	242, 319
AfiI	CCNNNNNNNGG	1 cut(s)	483
AflII	CTTAAG	1 cut(s)	62
AgsI	TTSAA	1 cut(s)	53
AluBI	AGCT	1 cut(s)	105
AluI	AGCT	1 cut(s)	105
Alw26I	GTCTC	1 cut(s)	200
AlwI	GGATC	1 cut(s)	241
ApoI	RAATTY	2 cut(s)	242, 319
ArsI	GACNNNNNNTTYG	2 cut(s)	355, 387
AspLEI	GCGC	2 cut(s)	370, 489
AsuHPI	GGTGA	2 cut(s)	155, 431
BbsI	GAAGAC	1 cut(s)	153
BccI	CCATC	1 cut(s)	433
BceAI	ACGGC	7 cut(s)	329, 346, 361, 381, 420, 474, 495
BcgI	CGANNNNNNTGC	2 cut(s)	408, 442
BcoDI	GTCTC	1 cut(s)	200
BfaI	CTAG	1 cut(s)	191
BfmI	CTRYAG	1 cut(s)	78
BfoI	RGCGCY	1 cut(s)	490
BfrI	CTTAAG	1 cut(s)	62
BmsI	GCATC	3 cut(s)	73, 387, 428
BpiI	GAAGAC	1 cut(s)	153
BpmI	CTGGAG	1 cut(s)	222
BsaI	GGTCTC	1 cut(s)	200
BsaJI	CCNNGG	2 cut(s)	345, 477
Bsc4I	CCNNNNNNNGG	1 cut(s)	483
BseDI	CCNNGG	2 cut(s)	345, 477
BseGI	GGATG	1 cut(s)	291
BseLI	CCNNNNNNNGG	1 cut(s)	483
BseRI	GAGGAG	1 cut(s)	141
Bsh1236I	CGCG	1 cut(s)	410
BslI	CCNNNNNNNGG	1 cut(s)	483
BsmAI	GTCTC	1 cut(s)	200
Bso31I	GGTCTC	1 cut(s)	200
Bsp143I	GATC	1 cut(s)	233
BspFNI	CGCG	1 cut(s)	410
BspMAI	CTGCAG	1 cut(s)	82
BspPI	GGATC	1 cut(s)	241
BspTI	CTTAAG	1 cut(s)	62
BspTNI	GGTCTC	1 cut(s)	200
BssECI	CCNNGG	2 cut(s)	345, 477
BssMI	GATC	1 cut(s)	233
Bst4CI	ACNGT	1 cut(s)	274
BstAFI	CTTAAG	1 cut(s)	62
BstDEI	CTNAG	1 cut(s)	180
BstDSI	CCRYGG	2 cut(s)	345, 477
BstF5I	GGATG	1 cut(s)	291
BstFNI	CGCG	1 cut(s)	410
BstH2I	RGCGCY	1 cut(s)	490
BstHHI	GCGC	2 cut(s)	370, 489
BstKTI	GATC	1 cut(s)	236
BstMAI	GTCTC	1 cut(s)	200
BstMBI	GATC	1 cut(s)	233
BstMWI	GCNNNNNNNGC	2 cut(s)	416, 467
BstSFI	CTRYAG	1 cut(s)	78
BstUI	CGCG	1 cut(s)	410
BstV2I	GAAGAC	1 cut(s)	153
BtgI	CCRYGG	2 cut(s)	345, 477
BtgZI	GCGATG	3 cut(s)	405, 410, 411
BtsCI	GGATG	1 cut(s)	291
BtsI	GCAGTG	1 cut(s)	75
BtsIMutI	CAGTG	3 cut(s)	75, 243, 256
CfoI	GCGC	2 cut(s)	370, 489
CviAII	CATG	2 cut(s)	217, 483
CviJI	RGCY	5 cut(s)	105, 350, 435, 470, 495
CviKI_1	RGCY	5 cut(s)	105, 350, 435, 470, 495
DdeI	CTNAG	1 cut(s)	180
DpnI	GATC	1 cut(s)	235
DpnII	GATC	1 cut(s)	233
Eco31I	GGTCTC	1 cut(s)	200
FaeI	CATG	2 cut(s)	220, 486
FaiI	YATR	5 cut(s)	20, 126, 218, 284, 484
FalI	AAGNNNNNCTT	2 cut(s)	45, 77
FatI	CATG	2 cut(s)	216, 482
FokI	GGATG	1 cut(s)	278
FspBI	CTAG	1 cut(s)	191
GlaI	GCGC	2 cut(s)	369, 488
GsuI	CTGGAG	1 cut(s)	222
HaeII	RGCGCY	1 cut(s)	490
HhaI	GCGC	2 cut(s)	370, 489
Hin1II	CATG	2 cut(s)	220, 486
Hin6I	GCGC	2 cut(s)	368, 487
HinP1I	GCGC	2 cut(s)	368, 487
HinfI	GANTC	1 cut(s)	146
HphI	GGTGA	2 cut(s)	155, 431
Hpy188I	TCNGA	1 cut(s)	40
Hpy188III	TCNNGA	1 cut(s)	201
Hpy99I	CGWCG	4 cut(s)	332, 367, 382, 460
HpyAV	CCTTC	1 cut(s)	321
HpyCH4III	ACNGT	1 cut(s)	274
HpyCH4V	TGCA	2 cut(s)	7, 80
HpyF10VI	GCNNNNNNNGC	2 cut(s)	416, 467
HpyF3I	CTNAG	1 cut(s)	180
Hsp92II	CATG	2 cut(s)	220, 486
HspAI	GCGC	2 cut(s)	368, 487
Kzo9I	GATC	1 cut(s)	233
LpnPI	CCDG	1 cut(s)	186
LweI	GCATC	3 cut(s)	73, 387, 428
MaeI	CTAG	1 cut(s)	191
MaeIII	GTNAC	2 cut(s)	143, 437
MalI	GATC	1 cut(s)	235
MboI	GATC	1 cut(s)	233
MboII	GAAGA	3 cut(s)	65, 68, 153
MluCI	AATT	3 cut(s)	242, 276, 319
MlyI	GAGTC	1 cut(s)	140
MmeI	TCCRAC	1 cut(s)	393
MnlI	CCTC	1 cut(s)	162
MseI	TTAA	2 cut(s)	63, 264
MspCI	CTTAAG	1 cut(s)	62
MvnI	CGCG	1 cut(s)	410
MwoI	GCNNNNNNNGC	2 cut(s)	416, 467
NdeII	GATC	1 cut(s)	233
NlaIII	CATG	2 cut(s)	220, 486
NmuCI	GTSAC	2 cut(s)	143, 437
PflMI	CCANNNNNTGG	1 cut(s)	483
PleI	GAGTC	1 cut(s)	140
PpsI	GAGTC	1 cut(s)	140
PstI	CTGCAG	1 cut(s)	82
SaqAI	TTAA	2 cut(s)	63, 264
Sau3AI	GATC	1 cut(s)	233
SchI	GAGTC	1 cut(s)	140
SetI	ASST	4 cut(s)	107, 186, 196, 313
SfaNI	GCATC	3 cut(s)	73, 387, 428
SfcI	CTRYAG	1 cut(s)	78
SmlI	CTYRAG	1 cut(s)	62
SmoI	CTYRAG	1 cut(s)	62
Sse9I	AATT	3 cut(s)	242, 276, 319
SspI	AATATT	2 cut(s)	96, 390
SspMI	CTAG	1 cut(s)	191
TaaI	ACNGT	1 cut(s)	274
TasI	AATT	3 cut(s)	242, 276, 319
Tru1I	TTAA	2 cut(s)	63, 264
Tru9I	TTAA	2 cut(s)	63, 264
TscAI	CASTG	3 cut(s)	82, 243, 256
TseFI	GTSAC	2 cut(s)	143, 437
Tsp45I	GTSAC	2 cut(s)	143, 437
TspDTI	ATGAA	1 cut(s)	165
TspRI	CASTG	3 cut(s)	82, 243, 256
Van91I	CCANNNNNTGG	1 cut(s)	483
Vha464I	CTTAAG	1 cut(s)	62
XapI	RAATTY	2 cut(s)	242, 319
XspI	CTAG	1 cut(s)	191

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.