Rh7DG079500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
6326125 .. 6341779
15655 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG079500.1

Sequence Viewer

Length: 192 bp
ATGACCGTGGAATCCACCATTAGCGTCTTCACCGTCCACATCGACCACCGCCATACCGTCATTATCATGATGAGCTGTTGCAAATGGTGCAATCTAAAACTTGCAAATGCTTTCTCATCGGAGAGTTCCATTGAAGAAGAACTTAAGAGTGAAAGCACTGCAAATGCTATTACAATATTGGTAGGGCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

6.97

Weight (kDa)

5.4

Isoelectric Point (pI)

66.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 49
AflII CTTAAG 1 cut(s) 143
AgsI TTSAA 1 cut(s) 134
AluBI AGCT 1 cut(s) 75
AluI AGCT 1 cut(s) 75
AsuHPI GGTGA 1 cut(s) 22
BbsI GAAGAC 1 cut(s) 19
BfrI CTTAAG 1 cut(s) 143
BpiI GAAGAC 1 cut(s) 19
BsaJI CCNNGG 1 cut(s) 6
BseDI CCNNGG 1 cut(s) 6
BspACI CCGC 1 cut(s) 49
BspHI TCATGA 1 cut(s) 66
BspTI CTTAAG 1 cut(s) 143
BssECI CCNNGG 1 cut(s) 6
Bst4CI ACNGT 3 cut(s) 7, 34, 58
BstAFI CTTAAG 1 cut(s) 143
BstAPI GCANNNNNTGC 1 cut(s) 87
BstDSI CCRYGG 1 cut(s) 6
BstMWI GCNNNNNNNGC 1 cut(s) 87
BstV2I GAAGAC 1 cut(s) 19
BtgI CCRYGG 1 cut(s) 6
BtsI GCAGTG 1 cut(s) 156
BtsIMutI CAGTG 1 cut(s) 156
CciI TCATGA 1 cut(s) 66
CseI GACGC 1 cut(s) 13
CviAII CATG 1 cut(s) 67
CviJI RGCY 2 cut(s) 75, 187
CviKI_1 RGCY 2 cut(s) 75, 187
FaeI CATG 1 cut(s) 70
FaiI YATR 2 cut(s) 54, 68
FalI AAGNNNNNCTT 2 cut(s) 126, 158
FatI CATG 1 cut(s) 66
HgaI GACGC 1 cut(s) 13
Hin1II CATG 1 cut(s) 70
HinfI GANTC 1 cut(s) 11
HphI GGTGA 1 cut(s) 22
Hpy166II GTNNAC 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 121
Hpy188III TCNNGA 1 cut(s) 67
Hpy8I GTNNAC 1 cut(s) 37
HpyCH4III ACNGT 3 cut(s) 7, 34, 58
HpyCH4V TGCA 4 cut(s) 81, 90, 104, 161
HpyF10VI GCNNNNNNNGC 1 cut(s) 87
Hsp92II CATG 1 cut(s) 70
MboII GAAGA 3 cut(s) 19, 146, 149
MseI TTAA 2 cut(s) 144, 190
MslI CAYNNNNRTG 1 cut(s) 65
MspCI CTTAAG 1 cut(s) 143
MwoI GCNNNNNNNGC 1 cut(s) 87
NlaIII CATG 1 cut(s) 70
PagI TCATGA 1 cut(s) 66
PfeI GAWTC 1 cut(s) 11
RseI CAYNNNNRTG 1 cut(s) 65
SaqAI TTAA 2 cut(s) 144, 190
SetI ASST 1 cut(s) 77
SgeI CNNG 3 cut(s) 19, 79, 113
SmiMI CAYNNNNRTG 1 cut(s) 65
SmlI CTYRAG 1 cut(s) 143
SmoI CTYRAG 1 cut(s) 143
SsiI CCGC 1 cut(s) 49
SspI AATATT 1 cut(s) 177
TaaI ACNGT 3 cut(s) 7, 34, 58
TaqI TCGA 1 cut(s) 42
TfiI GAWTC 1 cut(s) 11
Tru1I TTAA 2 cut(s) 144, 190
Tru9I TTAA 2 cut(s) 144, 190
TscAI CASTG 1 cut(s) 163
TspRI CASTG 1 cut(s) 163
Vha464I CTTAAG 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.