Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr1A

Orthogroup ID

OG0002279

Physical Location & Seq

Genomic Coordinates Reverse (-)

38026677 .. 38027241

Gene Structure 565 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh1AG199900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 180 bp

ATGGTGCAATCTAAAAACTTAACACTATCTTTCTCATCGGAGAGTTCCATTGAAGAAGAACTTAAGAGTGAAAGCACTGCAGATGCTATTACAATATTGGTCCATGAAGGTGCATTTGGTTCTATTGGTGATGATCAGTCACTTCTTAAATACTTGGAATCTCTGGGACAACATCAGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000323 GO:0003674 GO:0005488 GO:0005496 GO:0005575 GO:0005576 GO:0005622 GO:0005623 GO:0005634 GO:0005635 GO:0005737 GO:0005764 GO:0005773 GO:0005783 GO:0005886 GO:0005887 GO:0006082 GO:0006464 GO:0006486 GO:0006629 GO:0006807 GO:0006810 GO:0006869 GO:0007034 GO:0007041 GO:0008150 GO:0008152 GO:0008202 GO:0008206 GO:0008289 GO:0009058 GO:0009059 GO:0009100 GO:0009101 GO:0009987 GO:0010876 GO:0012505 GO:0015485 GO:0015850 GO:0015918 GO:0016020 GO:0016021 GO:0019538 GO:0019752 GO:0030301 GO:0031224 GO:0031226 GO:0031967 GO:0031975 GO:0032787 GO:0032934 GO:0033036 GO:0034645 GO:0036094 GO:0036211 GO:0042592 GO:0042632 GO:0043170 GO:0043178 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0043413 GO:0043436 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044281 GO:0044422 GO:0044424 GO:0044425 GO:0044428 GO:0044444 GO:0044446 GO:0044459 GO:0044464 GO:0048471 GO:0048878 GO:0051179 GO:0051234 GO:0055088 GO:0055092 GO:0065007 GO:0065008 GO:0070085 GO:0071702 GO:0071704 GO:0071944 GO:0097159 GO:1901135 GO:1901137 GO:1901360 GO:1901564 GO:1901566 GO:1901576 GO:1901615

KEGG Pathways

Metabolic & Signaling

ko04142 ko04979 map04142 map04979

Pfam Domains

Protein Families

NPC1_N Patched

Protein Analysis

59

Amino Acids

6.4

Weight (kDa)

4.35

Isoelectric Point (pI)

63.58

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002279)

Species	Orthologous Gene IDs
malus_domestica	MD00G1080500.v1.1 MD16G1285200.v1.1
rosa_chinensis	RchiOBHm_Chr2g0175261 RchiOBHm_Chr6g0280801
rosa_laevigata	RLG00000013082 RLG00000019605 RLG00000033344 RLG00000034484 RLG00000036984
rosa_multiflora	Rmu_sc0000893.1_g000002 Rmu_sc0002494.1_g000006 Rmu_sc0007139.1_g000001
rosa_roxburghii	Rroxscaffold_4G00312410 Rroxscaffold_7G00187620
rosa_rugosa	Rorug01G0060900 Rorug02G0158200 Rorug02G0250000 Rorug06G0134700
rosa_samantha	Rh1AG184800 Rh1AG199900 Rh1AG262300 Rh1BG097700 Rh1BG103100 Rh2CG636900 Rh2DG687600 Rh3CG050700 Rh3DG112000 Rh4CG020800 Rh4CG194300 Rh4DG079900 Rh5AG202600 Rh5BG321300 Rh5CG365700 Rh6AG170000 Rh6CG250600 Rh6DG242200 Rh6DG280400 Rh7AG279500 Rh7CG298700 Rh7CG343600 Rh7DG079500
rosa_wichuraiana	Rw4G014860 Rw6G026540

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AflII	CTTAAG	1 cut(s)	62
AgsI	TTSAA	1 cut(s)	53
AjuI	GAANNNNNNNTTGG	2 cut(s)	99, 131
AspS9I	GGNCC	1 cut(s)	100
AsuHPI	GGTGA	1 cut(s)	140
AvaII	GGWCC	1 cut(s)	100
BclI	TGATCA	1 cut(s)	133
BfmI	CTRYAG	1 cut(s)	78
BfrI	CTTAAG	1 cut(s)	62
Bme18I	GGWCC	1 cut(s)	100
BmgT120I	GGNCC	1 cut(s)	100
BmsI	GCATC	1 cut(s)	73
Bsp143I	GATC	1 cut(s)	133
BspMAI	CTGCAG	1 cut(s)	82
BspTI	CTTAAG	1 cut(s)	62
BssMI	GATC	1 cut(s)	133
BstAFI	CTTAAG	1 cut(s)	62
BstKTI	GATC	1 cut(s)	136
BstMBI	GATC	1 cut(s)	133
BstSFI	CTRYAG	1 cut(s)	78
BtsI	GCAGTG	1 cut(s)	75
BtsIMutI	CAGTG	1 cut(s)	75
Cfr13I	GGNCC	1 cut(s)	100
CviAII	CATG	1 cut(s)	104
DpnI	GATC	1 cut(s)	135
DpnII	GATC	1 cut(s)	133
Eco47I	GGWCC	1 cut(s)	100
FaeI	CATG	1 cut(s)	107
FaiI	YATR	1 cut(s)	105
FalI	AAGNNNNNCTT	2 cut(s)	45, 77
FatI	CATG	1 cut(s)	103
FbaI	TGATCA	1 cut(s)	133
Hin1II	CATG	1 cut(s)	107
HinfI	GANTC	1 cut(s)	158
HphI	GGTGA	1 cut(s)	140
Hpy188I	TCNGA	1 cut(s)	40
HpyAV	CCTTC	1 cut(s)	101
HpyCH4V	TGCA	3 cut(s)	7, 80, 113
Hsp92II	CATG	1 cut(s)	107
Ksp22I	TGATCA	1 cut(s)	133
Kzo9I	GATC	1 cut(s)	133
LpnPI	CCDG	1 cut(s)	149
LweI	GCATC	1 cut(s)	73
MaeIII	GTNAC	1 cut(s)	138
MalI	GATC	1 cut(s)	135
MboI	GATC	1 cut(s)	133
MboII	GAAGA	2 cut(s)	65, 68
MseI	TTAA	3 cut(s)	20, 63, 147
MslI	CAYNNNNRTG	1 cut(s)	108
MspCI	CTTAAG	1 cut(s)	62
NdeII	GATC	1 cut(s)	133
NlaIII	CATG	1 cut(s)	107
NmuCI	GTSAC	1 cut(s)	138
PfeI	GAWTC	1 cut(s)	158
PspPI	GGNCC	1 cut(s)	100
PstI	CTGCAG	1 cut(s)	82
RseI	CAYNNNNRTG	1 cut(s)	108
SaqAI	TTAA	3 cut(s)	20, 63, 147
Sau3AI	GATC	1 cut(s)	133
Sau96I	GGNCC	1 cut(s)	100
SetI	ASST	1 cut(s)	112
SfaNI	GCATC	1 cut(s)	73
SfcI	CTRYAG	1 cut(s)	78
SgeI	CNNG	3 cut(s)	116, 166, 176
SinI	GGWCC	1 cut(s)	100
SmiMI	CAYNNNNRTG	1 cut(s)	108
SmlI	CTYRAG	1 cut(s)	62
SmoI	CTYRAG	1 cut(s)	62
SspI	AATATT	1 cut(s)	96
TfiI	GAWTC	1 cut(s)	158
Tru1I	TTAA	3 cut(s)	20, 63, 147
Tru9I	TTAA	3 cut(s)	20, 63, 147
TscAI	CASTG	1 cut(s)	82
TseFI	GTSAC	1 cut(s)	138
Tsp45I	GTSAC	1 cut(s)	138
TspDTI	ATGAA	1 cut(s)	120
TspRI	CASTG	1 cut(s)	82
Vha464I	CTTAAG	1 cut(s)	62
VpaK11BI	GGWCC	1 cut(s)	100

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.