Rroxscaffold_7G00187620

Niemann-Pick C1

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
27015866 .. 27020734
4869 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00187620.1

Sequence Viewer

Length: 153 bp
ATGCTTTCTGTTCTTGGATCTGTTGGATTTTTGAGTGCTGTGAGAGTTAAATCTACATTAATCATAATGGAAGTCATTCCTTACCTTGTTTTGGCTGTTGGTGTAGATAACATGTGTATATTGGTACATGCAATCACCGGAGTTACCTTTTAG

Protein Analysis

50

Amino Acids

5.29

Weight (kDa)

6.5

Isoelectric Point (pI)

5.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Patched PF02460 1 - 46 1.1e-07 Patched SSD
Sterol-sensing PF12349 2 - 46 1.5e-12 Sterol-sensing domain of SREBP cleavage-activation
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 25
AfaI GTAC 1 cut(s) 126
AfiI CCNNNNNNNGG 1 cut(s) 91
AflIII ACRYGT 1 cut(s) 111
AlwI GGATC 1 cut(s) 25
AseI ATTAAT 1 cut(s) 59
Asp700I GAANNNNTTC 1 cut(s) 75
AsuHPI GGTGA 1 cut(s) 127
BsaWI WCCGGW 1 cut(s) 137
Bsc4I CCNNNNNNNGG 1 cut(s) 91
BseLI CCNNNNNNNGG 1 cut(s) 91
BsiSI CCGG 1 cut(s) 138
BslI CCNNNNNNNGG 1 cut(s) 91
Bsp143I GATC 1 cut(s) 17
BspPI GGATC 1 cut(s) 25
BssMI GATC 1 cut(s) 17
BstKTI GATC 1 cut(s) 20
BstMBI GATC 1 cut(s) 17
BstNSI RCATGY 2 cut(s) 115, 131
BstX2I RGATCY 1 cut(s) 17
BstYI RGATCY 1 cut(s) 17
Csp6I GTAC 1 cut(s) 125
CviAII CATG 2 cut(s) 112, 128
CviJI RGCY 1 cut(s) 95
CviKI_1 RGCY 1 cut(s) 95
CviQI GTAC 1 cut(s) 125
DpnI GATC 1 cut(s) 19
DpnII GATC 1 cut(s) 17
FaeI CATG 2 cut(s) 115, 131
FaiI YATR 4 cut(s) 65, 113, 119, 129
FatI CATG 2 cut(s) 111, 127
FspEI CC 8 cut(s) 9, 53, 77, 84, 93, 98, 107, 123
HapII CCGG 1 cut(s) 138
Hin1II CATG 2 cut(s) 115, 131
HpaII CCGG 1 cut(s) 138
HphI GGTGA 1 cut(s) 127
HpyCH4V TGCA 1 cut(s) 131
Hsp92II CATG 2 cut(s) 115, 131
Kzo9I GATC 1 cut(s) 17
MaeIII GTNAC 1 cut(s) 142
MalI GATC 1 cut(s) 19
MboI GATC 1 cut(s) 17
MflI RGATCY 1 cut(s) 17
MmeI TCCRAC 1 cut(s) 4
MroXI GAANNNNTTC 1 cut(s) 75
MseI TTAA 2 cut(s) 48, 59
MspI CCGG 1 cut(s) 138
NdeII GATC 1 cut(s) 17
NlaIII CATG 2 cut(s) 115, 131
NspI RCATGY 2 cut(s) 115, 131
PciI ACATGT 1 cut(s) 111
PdmI GAANNNNTTC 1 cut(s) 75
PscI ACATGT 1 cut(s) 111
PshBI ATTAAT 1 cut(s) 59
PsuI RGATCY 1 cut(s) 17
RsaI GTAC 1 cut(s) 126
RsaNI GTAC 1 cut(s) 125
SaqAI TTAA 2 cut(s) 48, 59
Sau3AI GATC 1 cut(s) 17
SetI ASST 2 cut(s) 87, 149
SgeI CNNG 4 cut(s) 26, 98, 124, 140
Tru1I TTAA 2 cut(s) 48, 59
Tru9I TTAA 2 cut(s) 48, 59
VspI ATTAAT 1 cut(s) 59
XceI RCATGY 2 cut(s) 115, 131
XmnI GAANNNNTTC 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.