Rmu_sc0000998.1_g000001

Truncated transcription factor CAULIFLOWER

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000998.1
Physical Location & Seq
Forward (+)
1118 .. 1579
462 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000998.1_g000001.1.cds

Sequence Viewer

Length: 243 bp
atgtatttgctggtggctgtaatgcaagaacagggaaagaagctgggagaagagaaggatctcatggaaaaggagattgcagcactgatggtggagaaggcgaaccagcaggaacagccaactgcgattgctgctgctaatgataatcatgatgatgaggaaatggaaggagaacgagaaggagaagcagatgagcgcagcagttgtgcccacaccaaacatcccgtgcttaatttgttttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

8.98

Weight (kDa)

4.49

Isoelectric Point (pI)

41.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 66
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
AlwI GGATC 1 cut(s) 66
ApeKI GCWGC 4 cut(s) 80, 131, 134, 198
AspLEI GCGC 1 cut(s) 198
BaeGI GKGCMC 1 cut(s) 211
BbvI GCAGC 4 cut(s) 92, 118, 121, 210
BccI CCATC 1 cut(s) 82
BisI GCNGC 4 cut(s) 81, 132, 135, 199
BlsI GCNGC 4 cut(s) 82, 133, 136, 200
BseGI GGATG 1 cut(s) 220
BseSI GKGCMC 1 cut(s) 211
BseXI GCAGC 4 cut(s) 92, 118, 121, 210
BseYI CCCAGC 1 cut(s) 43
Bsp1286I GDGCHC 1 cut(s) 211
Bsp143I GATC 1 cut(s) 58
BspHI TCATGA 1 cut(s) 148
BspPI GGATC 1 cut(s) 66
BssMI GATC 1 cut(s) 58
Bst6I CTCTTC 1 cut(s) 45
BstF5I GGATG 1 cut(s) 220
BstHHI GCGC 1 cut(s) 198
BstKTI GATC 1 cut(s) 61
BstMBI GATC 1 cut(s) 58
BstMWI GCNNNNNNNGC 2 cut(s) 115, 131
BstSLI GKGCMC 1 cut(s) 211
BstV1I GCAGC 4 cut(s) 92, 118, 121, 210
BstX2I RGATCY 1 cut(s) 58
BstYI RGATCY 1 cut(s) 58
BtsCI GGATG 1 cut(s) 220
BtsIMutI CAGTG 1 cut(s) 83
CciI TCATGA 1 cut(s) 148
CfoI GCGC 1 cut(s) 198
CviAII CATG 2 cut(s) 64, 149
CviJI RGCY 3 cut(s) 17, 43, 118
CviKI_1 RGCY 3 cut(s) 17, 43, 118
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
Eam1104I CTCTTC 1 cut(s) 45
EarI CTCTTC 1 cut(s) 45
FaeI CATG 2 cut(s) 67, 152
FaiI YATR 2 cut(s) 65, 150
FatI CATG 2 cut(s) 63, 148
Fnu4HI GCNGC 4 cut(s) 81, 132, 135, 199
FokI GGATG 1 cut(s) 207
Fsp4HI GCNGC 4 cut(s) 81, 132, 135, 199
GlaI GCGC 1 cut(s) 197
GluI GCNGC 4 cut(s) 81, 132, 135, 199
GsaI CCCAGC 1 cut(s) 47
HhaI GCGC 1 cut(s) 198
Hin1II CATG 2 cut(s) 67, 152
Hin6I GCGC 1 cut(s) 196
HinP1I GCGC 1 cut(s) 196
Hpy188III TCNNGA 1 cut(s) 149
HpyAV CCTTC 4 cut(s) 49, 91, 161, 173
HpyCH4V TGCA 2 cut(s) 25, 80
HpyF10VI GCNNNNNNNGC 2 cut(s) 115, 131
Hsp92II CATG 2 cut(s) 67, 152
HspAI GCGC 1 cut(s) 196
Kzo9I GATC 1 cut(s) 58
LpnPI CCDG 4 cut(s) 17, 29, 95, 119
Lsp1109I GCAGC 4 cut(s) 92, 118, 121, 210
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MboII GAAGA 1 cut(s) 62
MflI RGATCY 1 cut(s) 58
MhlI GDGCHC 1 cut(s) 211
MluCI AATT 1 cut(s) 232
MnlI CCTC 1 cut(s) 151
MseI TTAA 1 cut(s) 231
MslI CAYNNNNRTG 1 cut(s) 153
MwoI GCNNNNNNNGC 2 cut(s) 115, 131
NdeII GATC 1 cut(s) 58
NlaIII CATG 2 cut(s) 67, 152
PagI TCATGA 1 cut(s) 148
PkrI GCNGC 4 cut(s) 82, 133, 136, 200
PspFI CCCAGC 1 cut(s) 43
PsuI RGATCY 1 cut(s) 58
RseI CAYNNNNRTG 1 cut(s) 153
SaqAI TTAA 1 cut(s) 231
SatI GCNGC 4 cut(s) 81, 132, 135, 199
Sau3AI GATC 1 cut(s) 58
SduI GDGCHC 1 cut(s) 211
SetI ASST 1 cut(s) 45
SmiMI CAYNNNNRTG 1 cut(s) 153
Sse9I AATT 1 cut(s) 232
TasI AATT 1 cut(s) 232
Tru1I TTAA 1 cut(s) 231
Tru9I TTAA 1 cut(s) 231
TscAI CASTG 1 cut(s) 90
TseI GCWGC 4 cut(s) 80, 131, 134, 198
TspRI CASTG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.