Rmu_sc0001304.1_g000003

disease resistance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001304.1
Physical Location & Seq
Reverse (-)
5564 .. 6559
996 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001304.1_g000003.1.cds

Sequence Viewer

Length: 996 bp
atgtcattgatttcttccttaagtggaaaatcgatgattccatgccaggacatattggatgacatcgccaatgatgctctcgaatcacaaaacagcaaacctgaggtatggaattctaagatcaaagaagggatagactttaagatgaaagacattgctaatactcttaatccctttagggaacgtgtagagtcaaaaacgataaagattatagatgtattggaagagattgcaaagcagaaagatattcttcgtttgagagaagattttggcagtatagaatcaggttttgacggattgcccacgactccaatggtgggtgataaatctcatgtttatggtagagaatctgataaggaggagataattactttgctgaaatcgagtaaaaatgatcgtgaggtttctataattccaattgtaggcatgggagacaatgggaagactactcttgctcagcttgtgtataatgatgccaaagtgagtagctattttaatttgagagcatgggcttgtgtctctgatgtatttgatgtgcaaaggataacaaaaacacttgttgagtccgcgacaaaatcaagttgtagcacaaacaatttggagttacttcaagaacaactgaaaatacggttgaagaacaagaaatttctttttgttctggatgatgtctggaacgacaagtatgaaagctgggataagttaagagtccccttcacagttggtgcaccagggaataaaatcatgatcacgacacgaaacaaaacagttgcatcacttatggggactgttcctacttactgtttggaggggctttcggacagtgattgttggttattattcgaacaaattgtgtttcagaacaggaatttagatgcctatccaaagttgaaagtgattggcaagaaaatagcatacaagtgtaaagggttgccattggctgcaaaggcactaggaggtctcctgcgtgctgaaccggaactagatgagaattactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

331

Amino Acids

37.19

Weight (kDa)

6.11

Isoelectric Point (pI)

33.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 569
AciI CCGC 1 cut(s) 567
AcsI RAATTY 3 cut(s) 112, 644, 865
AfiI CCNNNNNNNGG 2 cut(s) 317, 422
AflII CTTAAG 1 cut(s) 19
AflIII ACRYGT 1 cut(s) 184
AgsI TTSAA 3 cut(s) 611, 634, 889
AjnI CCWGG 2 cut(s) 45, 727
AluBI AGCT 3 cut(s) 460, 489, 690
AluI AGCT 3 cut(s) 460, 489, 690
Alw21I GWGCWC 1 cut(s) 727
Alw26I GTCTC 3 cut(s) 426, 523, 962
Alw44I GTGCAC 1 cut(s) 723
ApaLI GTGCAC 1 cut(s) 723
ApeKI GCWGC 1 cut(s) 938
ApoI RAATTY 3 cut(s) 112, 644, 865
AsuHPI GGTGA 1 cut(s) 332
AsuII TTCGAA 1 cut(s) 840
AxyI CCTNAGG 1 cut(s) 102
BaeGI GKGCMC 1 cut(s) 727
BbsI GAAGAC 1 cut(s) 449
Bbv12I GWGCWC 1 cut(s) 727
BbvI GCAGC 1 cut(s) 925
BciT130I CCWGG 2 cut(s) 47, 729
BclI TGATCA 1 cut(s) 744
BcoDI GTCTC 3 cut(s) 426, 523, 962
BfaI CTAG 3 cut(s) 950, 980, 994
BfrI CTTAAG 1 cut(s) 19
BisI GCNGC 1 cut(s) 939
BlpI GCTNAGC 1 cut(s) 456
BlsI GCNGC 1 cut(s) 940
Bme1390I CCNGG 2 cut(s) 47, 729
BmrFI CCNGG 2 cut(s) 47, 729
BmsI GCATC 4 cut(s) 64, 463, 779, 862
BpiI GAAGAC 1 cut(s) 449
Bpu1102I GCTNAGC 1 cut(s) 456
Bpu14I TTCGAA 1 cut(s) 840
Bsa29I ATCGAT 1 cut(s) 32
BsaBI GATNNNNATC 1 cut(s) 876
BsaI GGTCTC 1 cut(s) 962
BsaJI CCNNGG 1 cut(s) 728
BsaWI WCCGGW 1 cut(s) 973
Bsc4I CCNNNNNNNGG 2 cut(s) 317, 422
Bse21I CCTNAGG 1 cut(s) 102
Bse3DI GCAATG 1 cut(s) 153
Bse8I GATNNNNATC 1 cut(s) 876
BseBI CCWGG 2 cut(s) 47, 729
BseCI ATCGAT 1 cut(s) 32
BseDI CCNNGG 1 cut(s) 728
BseGI GGATG 2 cut(s) 64, 667
BseJI GATNNNNATC 1 cut(s) 876
BseLI CCNNNNNNNGG 2 cut(s) 317, 422
BseMI GCAATG 1 cut(s) 153
BseMII CTCAG 2 cut(s) 93, 470
BseRI GAGGAG 1 cut(s) 374
BseSI GKGCMC 1 cut(s) 727
BseXI GCAGC 1 cut(s) 925
BseYI CCCAGC 1 cut(s) 690
Bsh1236I CGCG 1 cut(s) 569
BshVI ATCGAT 1 cut(s) 32
BsiHKAI GWGCWC 1 cut(s) 727
BsiSI CCGG 1 cut(s) 974
BslFI GGGAC 2 cut(s) 692, 796
BslI CCNNNNNNNGG 2 cut(s) 317, 422
BsmAI GTCTC 3 cut(s) 426, 523, 962
BsmFI GGGAC 2 cut(s) 692, 796
Bso31I GGTCTC 1 cut(s) 962
Bsp119I TTCGAA 1 cut(s) 840
Bsp1286I GDGCHC 1 cut(s) 727
Bsp143I GATC 3 cut(s) 120, 394, 744
Bsp1720I GCTNAGC 1 cut(s) 456
BspACI CCGC 1 cut(s) 567
BspCNI CTCAG 2 cut(s) 94, 469
BspDI ATCGAT 1 cut(s) 32
BspFNI CGCG 1 cut(s) 569
BspHI TCATGA 1 cut(s) 741
BspT104I TTCGAA 1 cut(s) 840
BspTI CTTAAG 1 cut(s) 19
BspTNI GGTCTC 1 cut(s) 962
BsrDI GCAATG 1 cut(s) 153
BssECI CCNNGG 1 cut(s) 728
BssMI GATC 3 cut(s) 120, 394, 744
Bst2UI CCWGG 2 cut(s) 47, 729
Bst4CI ACNGT 6 cut(s) 630, 718, 766, 787, 800, 821
Bst6I CTCTTC 1 cut(s) 219
BstAFI CTTAAG 1 cut(s) 19
BstBI TTCGAA 1 cut(s) 840
BstC8I GCNNGC 1 cut(s) 966
BstDEI CTNAG 3 cut(s) 102, 117, 456
BstF5I GGATG 2 cut(s) 64, 667
BstFNI CGCG 1 cut(s) 569
BstKTI GATC 3 cut(s) 123, 397, 747
BstMAI GTCTC 3 cut(s) 426, 523, 962
BstMBI GATC 3 cut(s) 120, 394, 744
BstMWI GCNNNNNNNGC 2 cut(s) 74, 944
BstNI CCWGG 2 cut(s) 47, 729
BstSCI CCNGG 2 cut(s) 45, 727
BstSLI GKGCMC 1 cut(s) 727
BstUI CGCG 1 cut(s) 569
BstV1I GCAGC 1 cut(s) 925
BstV2I GAAGAC 1 cut(s) 449
Bsu15I ATCGAT 1 cut(s) 32
Bsu36I CCTNAGG 1 cut(s) 102
BsuTUI ATCGAT 1 cut(s) 32
BtgZI GCGATG 1 cut(s) 49
BtsCI GGATG 2 cut(s) 64, 667
BtsIMutI CAGTG 1 cut(s) 826
Cac8I GCNNGC 1 cut(s) 966
CciI TCATGA 1 cut(s) 741
ClaI ATCGAT 1 cut(s) 32
CviAII CATG 5 cut(s) 42, 332, 427, 507, 742
CviJI RGCY 6 cut(s) 460, 489, 512, 690, 811, 938
CviKI_1 RGCY 6 cut(s) 460, 489, 512, 690, 811, 938
DdeI CTNAG 3 cut(s) 102, 117, 456
DpnI GATC 3 cut(s) 122, 396, 746
DpnII GATC 3 cut(s) 120, 394, 744
Eam1104I CTCTTC 1 cut(s) 219
EarI CTCTTC 1 cut(s) 219
Eco31I GGTCTC 1 cut(s) 962
Eco81I CCTNAGG 1 cut(s) 102
EcoRI GAATTC 1 cut(s) 112
EcoRII CCWGG 2 cut(s) 45, 727
FaeI CATG 5 cut(s) 45, 335, 430, 510, 745
FalI AAGNNNNNCTT 2 cut(s) 234, 266
FaqI GGGAC 2 cut(s) 692, 796
FatI CATG 5 cut(s) 41, 331, 426, 506, 741
FbaI TGATCA 1 cut(s) 744
Fnu4HI GCNGC 1 cut(s) 939
FokI GGATG 2 cut(s) 71, 674
Fsp4HI GCNGC 1 cut(s) 939
FspBI CTAG 3 cut(s) 950, 980, 994
GluI GCNGC 1 cut(s) 939
GsaI CCCAGC 1 cut(s) 694
HapII CCGG 1 cut(s) 974
Hin1II CATG 5 cut(s) 45, 335, 430, 510, 745
HinfI GANTC 8 cut(s) 37, 83, 191, 281, 307, 347, 563, 705
HpaII CCGG 1 cut(s) 974
HphI GGTGA 1 cut(s) 332
Hpy166II GTNNAC 1 cut(s) 725
Hpy188I TCNGA 4 cut(s) 352, 523, 817, 858
Hpy188III TCNNGA 7 cut(s) 80, 398, 611, 659, 670, 742, 748
Hpy8I GTNNAC 1 cut(s) 725
HpyAV CCTTC 2 cut(s) 122, 721
HpyCH4III ACNGT 6 cut(s) 630, 718, 766, 787, 800, 821
HpyCH4IV ACGT 1 cut(s) 184
HpyCH4V TGCA 5 cut(s) 233, 538, 725, 770, 941
HpyF10VI GCNNNNNNNGC 2 cut(s) 74, 944
HpyF3I CTNAG 3 cut(s) 102, 117, 456
HpySE526I ACGT 1 cut(s) 184
Hsp92II CATG 5 cut(s) 45, 335, 430, 510, 745
Ksp22I TGATCA 1 cut(s) 744
Kzo9I GATC 3 cut(s) 120, 394, 744
Lsp1109I GCAGC 1 cut(s) 925
LweI GCATC 4 cut(s) 64, 463, 779, 862
MaeI CTAG 3 cut(s) 950, 980, 994
MaeII ACGT 1 cut(s) 184
MaeIII GTNAC 1 cut(s) 603
MalI GATC 3 cut(s) 122, 396, 746
MboI GATC 3 cut(s) 120, 394, 744
MboII GAAGA 6 cut(s) 6, 236, 242, 275, 454, 646
MfeI CAATTG 1 cut(s) 417
MhlI GDGCHC 1 cut(s) 727
MlyI GAGTC 4 cut(s) 200, 301, 572, 714
MnlI CCTC 5 cut(s) 97, 352, 394, 799, 947
MseI TTAA 5 cut(s) 20, 141, 168, 495, 701
MslI CAYNNNNRTG 2 cut(s) 336, 916
MspCI CTTAAG 1 cut(s) 19
MspI CCGG 1 cut(s) 974
MspR9I CCNGG 2 cut(s) 47, 729
MunI CAATTG 1 cut(s) 417
MvaI CCWGG 2 cut(s) 47, 729
MvnI CGCG 1 cut(s) 569
MwoI GCNNNNNNNGC 2 cut(s) 74, 944
NdeII GATC 3 cut(s) 120, 394, 744
NlaIII CATG 5 cut(s) 45, 335, 430, 510, 745
NspV TTCGAA 1 cut(s) 840
PagI TCATGA 1 cut(s) 741
PfeI GAWTC 4 cut(s) 37, 83, 281, 347
PkrI GCNGC 1 cut(s) 940
PleI GAGTC 4 cut(s) 199, 301, 571, 713
PpsI GAGTC 4 cut(s) 199, 301, 571, 713
Psp6I CCWGG 2 cut(s) 45, 727
PspFI CCCAGC 1 cut(s) 690
PspGI CCWGG 2 cut(s) 45, 727
RseI CAYNNNNRTG 2 cut(s) 336, 916
SaqAI TTAA 5 cut(s) 20, 141, 168, 495, 701
SatI GCNGC 1 cut(s) 939
Sau3AI GATC 3 cut(s) 120, 394, 744
SchI GAGTC 4 cut(s) 200, 301, 572, 714
ScrFI CCNGG 2 cut(s) 47, 729
SduI GDGCHC 1 cut(s) 727
SetI ASST 9 cut(s) 103, 108, 187, 289, 405, 462, 491, 692, 958
SfaNI GCATC 4 cut(s) 64, 463, 779, 862
SfuI TTCGAA 1 cut(s) 840
SmiMI CAYNNNNRTG 2 cut(s) 336, 916
SmlI CTYRAG 1 cut(s) 19
SmoI CTYRAG 1 cut(s) 19
SsiI CCGC 1 cut(s) 567
SspMI CTAG 3 cut(s) 950, 980, 994
StyD4I CCNGG 2 cut(s) 45, 727
TaaI ACNGT 6 cut(s) 630, 718, 766, 787, 800, 821
TaiI ACGT 1 cut(s) 187
TaqI TCGA 4 cut(s) 32, 81, 383, 840
TfiI GAWTC 4 cut(s) 37, 83, 281, 347
Tru1I TTAA 5 cut(s) 20, 141, 168, 495, 701
Tru9I TTAA 5 cut(s) 20, 141, 168, 495, 701
TscAI CASTG 1 cut(s) 826
TseI GCWGC 1 cut(s) 938
TspDTI ATGAA 2 cut(s) 161, 699
TspGWI ACGGA 1 cut(s) 309
TspRI CASTG 1 cut(s) 826
Vha464I CTTAAG 1 cut(s) 19
VneI GTGCAC 1 cut(s) 723
XapI RAATTY 3 cut(s) 112, 644, 865
XcmI CCANNNNNNNNNTGG 1 cut(s) 310
XspI CTAG 3 cut(s) 950, 980, 994
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.