Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001459.1

Orthogroup ID

OG0003515

Physical Location & Seq

Genomic Coordinates Reverse (-)

67958 .. 69539

Gene Structure 1582 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 837 bp

atgttgtggcatttgcaatttctgtgttctcagtttcggcatcaggatggaaggcaactctatggcttcttaaggattgaaatcctaggtgctctcgtttcaatccttataatatggctcactgctggtattctaatttatgaagccattgagagacttcagaatggcaaccctggcgaagttaagggctctctcatgtttattgtttccaccgtgggtctagtgcttaacatcgccatggcggtcttgttgggtcatgatcacaaccatggcaacaaccatggtgatcatcatcataacgaggatcatgatgatcatcctcatgatgatgatgatcatacagataacaatgggacacatcacaatcgtcgcaatatgaacctccatggggcatatcttcatgtacttggggatatcattcagagcattggagtgatggtcaccgcagaggtcatatgggctaagcctgaatggaagatcgctgatctcatatgcacactaatattttcaatagctgtgctggctacaaccatcggcatgctgcggaaaattgttggggttcttatggagagcactccaagagggatcgacaccttaaagcttgagaaagctttgtgtgagctggatgcagtagttgcctgtcatgaactgcacatatgctggaagaaccttgcagctaaagaaatcgctatattaaaacttgcttatacccatttgctggaagaatcaaacacaattcctccattgactgcaatgatgatggagcggggttcactgaagctcaattcagctgccttcttgcagacattctcaaagcaacagaccacgaggtactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000041 GO:0003674 GO:0005215 GO:0005385 GO:0006810 GO:0006811 GO:0006812 GO:0006829 GO:0008150 GO:0008324 GO:0015075 GO:0015318 GO:0022857 GO:0022890 GO:0030001 GO:0032879 GO:0034220 GO:0042592 GO:0046873 GO:0046915 GO:0048878 GO:0050789 GO:0050794 GO:0050801 GO:0051179 GO:0051234 GO:0055085 GO:0061088 GO:0065007 GO:0065008 GO:0070838 GO:0071577 GO:0072509 GO:0072511 GO:0098655 GO:0098660 GO:0098662

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cation_efflux

Protein Analysis

278

Amino Acids

31.22

Weight (kDa)

6.1

Isoelectric Point (pI)

33.82

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Cation_efflux	PF01545	14 - 189	2.3e-26	Cation efflux transmembrane domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003515)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G58810 AT3G58810
fragaria_vesca	FvH4_5g10450 FvH4_5g10450 FvH4_5g10450
malus_domestica	MD06G1123800.v1.1 MD13G1032200.v1.1 MD14G1140000.v1.1 MD14G1140800.v1.1
prunus_persica	Prupe.5G134300_v2.0.a1 Prupe.5G134300_v2.0.a1 Prupe.5G134300_v2.0.a1
pyrus_communis	pycom14g11570
rosa_chinensis	RchiOBHm_Chr4g0431771 RchiOBHm_Chr7g0187761
rosa_laevigata	RLG00000004758 RLG00000006891
rosa_multiflora	Rmu_sc0001459.1_g000019 Rmu_sc0004483.1_g000029
rosa_roxburghii	Rroxscaffold_3G00267100 Rroxscaffold_5G00373170 Rroxscaffold_5G00373180
rosa_rugosa	Rorug04G0252300 Rorug06G0484000.1
rosa_samantha	Rh4AG308700 Rh4BG316500 Rh4CG331900 Rh4DG311400 Rh7AG089100 Rh7BG090900 Rh7CG089900 Rh7DG091500
rosa_wichuraiana	Rw0G003020 Rw4G026780 Rw7G007690

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	110
AccB7I	CCANNNNNTGG	1 cut(s)	718
AccBSI	CCGCTC	1 cut(s)	766
AciI	CCGC	4 cut(s)	242, 444, 544, 766
AclWI	GGATC	2 cut(s)	312, 593
AcuI	CTGAAG	2 cut(s)	143, 797
AfaI	GTAC	2 cut(s)	405, 833
AfiI	CCNNNNNNNGG	2 cut(s)	388, 718
AflII	CTTAAG	1 cut(s)	70
AgsI	TTSAA	3 cut(s)	80, 102, 510
AjnI	CCWGG	1 cut(s)	172
AluBI	AGCT	7 cut(s)	515, 601, 611, 622, 677, 781, 791
AluI	AGCT	7 cut(s)	515, 601, 611, 622, 677, 781, 791
Alw21I	GWGCWC	2 cut(s)	94, 575
Alw26I	GTCTC	1 cut(s)	148
AlwI	GGATC	2 cut(s)	312, 593
ApeKI	GCWGC	3 cut(s)	541, 674, 791
AspA2I	CCTAGG	1 cut(s)	85
AsuHPI	GGTGA	2 cut(s)	296, 433
AvrII	CCTAGG	1 cut(s)	85
BanII	GRGCYC	1 cut(s)	191
BauI	CACGAG	1 cut(s)	826
Bbv12I	GWGCWC	2 cut(s)	94, 575
BbvI	GCAGC	3 cut(s)	528, 686, 778
BccI	CCATC	4 cut(s)	41, 430, 539, 754
BciT130I	CCWGG	1 cut(s)	174
BclI	TGATCA	4 cut(s)	259, 286, 313, 334
BcoDI	GTCTC	1 cut(s)	148
BfaI	CTAG	2 cut(s)	86, 221
BfrI	CTTAAG	1 cut(s)	70
BisI	GCNGC	3 cut(s)	542, 675, 792
BlnI	CCTAGG	1 cut(s)	85
BlpI	GCTNAGC	1 cut(s)	462
BlsI	GCNGC	3 cut(s)	543, 676, 793
Bme1390I	CCNGG	1 cut(s)	174
BmrFI	CCNGG	1 cut(s)	174
BmsI	GCATC	2 cut(s)	49, 616
Bpu1102I	GCTNAGC	1 cut(s)	462
BpuEI	CTTGAG	1 cut(s)	623
BsaBI	GATNNNNATC	4 cut(s)	80, 291, 315, 333
BsaJI	CCNNGG	7 cut(s)	85, 172, 213, 237, 268, 280, 385
BsaXI	ACNNNNNCTCC	4 cut(s)	423, 453, 724, 754
Bsc4I	CCNNNNNNNGG	2 cut(s)	388, 718
Bse3DI	GCAATG	1 cut(s)	759
Bse8I	GATNNNNATC	4 cut(s)	80, 291, 315, 333
BseBI	CCWGG	1 cut(s)	174
BseDI	CCNNGG	7 cut(s)	85, 172, 213, 237, 268, 280, 385
BseGI	GGATG	3 cut(s)	52, 316, 631
BseJI	GATNNNNATC	4 cut(s)	80, 291, 315, 333
BseLI	CCNNNNNNNGG	2 cut(s)	388, 718
BseMI	GCAATG	1 cut(s)	759
BseMII	CTCAG	1 cut(s)	44
BseXI	GCAGC	3 cut(s)	528, 686, 778
BsgI	GTGCAG	1 cut(s)	635
BsiHKAI	GWGCWC	2 cut(s)	94, 575
BslFI	GGGAC	1 cut(s)	367
BslI	CCNNNNNNNGG	2 cut(s)	388, 718
BsmAI	GTCTC	1 cut(s)	148
BsmFI	GGGAC	1 cut(s)	367
Bsp1286I	GDGCHC	3 cut(s)	94, 191, 575
Bsp143I	GATC	8 cut(s)	259, 286, 304, 313, 334, 477, 484, 585
Bsp1720I	GCTNAGC	1 cut(s)	462
Bsp19I	CCATGG	4 cut(s)	237, 268, 280, 385
BspACI	CCGC	4 cut(s)	242, 444, 544, 766
BspCNI	CTCAG	1 cut(s)	43
BspHI	TCATGA	4 cut(s)	256, 307, 322, 643
BspPI	GGATC	2 cut(s)	312, 593
BspTI	CTTAAG	1 cut(s)	70
BsrBI	CCGCTC	1 cut(s)	766
BsrDI	GCAATG	1 cut(s)	759
BssECI	CCNNGG	7 cut(s)	85, 172, 213, 237, 268, 280, 385
BssMI	GATC	8 cut(s)	259, 286, 304, 313, 334, 477, 484, 585
BssSI	CACGAG	1 cut(s)	826
BssT1I	CCWWGG	5 cut(s)	85, 237, 268, 280, 385
Bst2BI	CACGAG	1 cut(s)	826
Bst2UI	CCWGG	1 cut(s)	174
Bst4CI	ACNGT	1 cut(s)	214
BstAFI	CTTAAG	1 cut(s)	70
BstAPI	GCANNNNNTGC	1 cut(s)	635
BstC8I	GCNNGC	2 cut(s)	522, 539
BstDEI	CTNAG	2 cut(s)	30, 462
BstDSI	CCRYGG	5 cut(s)	213, 237, 268, 280, 385
BstEII	GGTNACC	1 cut(s)	439
BstF5I	GGATG	3 cut(s)	52, 316, 631
BstKTI	GATC	8 cut(s)	262, 289, 307, 316, 337, 480, 487, 588
BstMAI	GTCTC	1 cut(s)	148
BstMBI	GATC	8 cut(s)	259, 286, 304, 313, 334, 477, 484, 585
BstMWI	GCNNNNNNNGC	3 cut(s)	174, 521, 635
BstNI	CCWGG	1 cut(s)	174
BstNSI	RCATGY	1 cut(s)	541
BstPI	GGTNACC	1 cut(s)	439
BstSCI	CCNGG	1 cut(s)	172
BstV1I	GCAGC	3 cut(s)	528, 686, 778
BtgI	CCRYGG	5 cut(s)	213, 237, 268, 280, 385
BtgZI	GCGATG	1 cut(s)	217
BtsCI	GGATG	3 cut(s)	52, 316, 631
BtsI	GCAGTG	1 cut(s)	120
BtsIMutI	CAGTG	2 cut(s)	120, 773
Cac8I	GCNNGC	2 cut(s)	522, 539
CciI	TCATGA	4 cut(s)	256, 307, 322, 643
Csp6I	GTAC	2 cut(s)	404, 832
CviQI	GTAC	2 cut(s)	404, 832
DdeI	CTNAG	2 cut(s)	30, 462
DpnI	GATC	8 cut(s)	261, 288, 306, 315, 336, 479, 486, 587
DpnII	GATC	8 cut(s)	259, 286, 304, 313, 334, 477, 484, 585
Eco130I	CCWWGG	5 cut(s)	85, 237, 268, 280, 385
Eco24I	GRGCYC	1 cut(s)	191
Eco32I	GATATC	1 cut(s)	415
Eco57I	CTGAAG	2 cut(s)	143, 797
Eco91I	GGTNACC	1 cut(s)	439
EcoO65I	GGTNACC	1 cut(s)	439
EcoRII	CCWGG	1 cut(s)	172
EcoRV	GATATC	1 cut(s)	415
EcoT14I	CCWWGG	5 cut(s)	85, 237, 268, 280, 385
EcoT38I	GRGCYC	1 cut(s)	191
ErhI	CCWWGG	5 cut(s)	85, 237, 268, 280, 385
FaqI	GGGAC	1 cut(s)	367
FauI	CCCGC	1 cut(s)	759
FauNDI	CATATG	3 cut(s)	455, 491, 656
FbaI	TGATCA	4 cut(s)	259, 286, 313, 334
Fnu4HI	GCNGC	3 cut(s)	542, 675, 792
FokI	GGATG	3 cut(s)	59, 303, 638
FriOI	GRGCYC	1 cut(s)	191
Fsp4HI	GCNGC	3 cut(s)	542, 675, 792
FspBI	CTAG	2 cut(s)	86, 221
GluI	GCNGC	3 cut(s)	542, 675, 792
HindIII	AAGCTT	2 cut(s)	599, 609
HinfI	GANTC	1 cut(s)	725
HphI	GGTGA	2 cut(s)	296, 433
Hpy166II	GTNNAC	1 cut(s)	773
Hpy188I	TCNGA	2 cut(s)	162, 423
Hpy188III	TCNNGA	5 cut(s)	44, 257, 308, 323, 644
Hpy8I	GTNNAC	1 cut(s)	773
Hpy99I	CGWCG	1 cut(s)	372
HpyAV	CCTTC	2 cut(s)	45, 805
HpyCH4III	ACNGT	1 cut(s)	214
HpyCH4V	TGCA	7 cut(s)	16, 495, 629, 652, 674, 752, 802
HpyF10VI	GCNNNNNNNGC	3 cut(s)	174, 521, 635
HpyF3I	CTNAG	2 cut(s)	30, 462
Ksp22I	TGATCA	4 cut(s)	259, 286, 313, 334
Kzo9I	GATC	8 cut(s)	259, 286, 304, 313, 334, 477, 484, 585
LmnI	GCTCC	1 cut(s)	763
Lsp1109I	GCAGC	3 cut(s)	528, 686, 778
LweI	GCATC	2 cut(s)	49, 616
MaeI	CTAG	2 cut(s)	86, 221
MaeIII	GTNAC	1 cut(s)	439
MalI	GATC	8 cut(s)	261, 288, 306, 315, 336, 479, 486, 587
MbiI	CCGCTC	1 cut(s)	766
MboI	GATC	8 cut(s)	259, 286, 304, 313, 334, 477, 484, 585
MboII	GAAGA	4 cut(s)	389, 487, 676, 734
MhlI	GDGCHC	3 cut(s)	94, 191, 575
MluCI	AATT	5 cut(s)	17, 135, 549, 735, 784
MnlI	CCTC	7 cut(s)	295, 330, 392, 442, 575, 750, 822
MseI	TTAA	5 cut(s)	71, 183, 228, 596, 695
MslI	CAYNNNNRTG	7 cut(s)	45, 236, 267, 321, 327, 431, 536
MspA1I	CMGCKG	1 cut(s)	791
MspCI	CTTAAG	1 cut(s)	70
MspR9I	CCNGG	1 cut(s)	174
MvaI	CCWGG	1 cut(s)	174
MwoI	GCNNNNNNNGC	3 cut(s)	174, 521, 635
NcoI	CCATGG	4 cut(s)	237, 268, 280, 385
NdeI	CATATG	3 cut(s)	455, 491, 656
NdeII	GATC	8 cut(s)	259, 286, 304, 313, 334, 477, 484, 585
NmuCI	GTSAC	1 cut(s)	439
NspI	RCATGY	1 cut(s)	541
PaeI	GCATGC	1 cut(s)	541
PagI	TCATGA	4 cut(s)	256, 307, 322, 643
PfeI	GAWTC	1 cut(s)	725
PflMI	CCANNNNNTGG	1 cut(s)	718
PkrI	GCNGC	3 cut(s)	543, 676, 793
PsiI	TTATAA	1 cut(s)	110
Psp6I	CCWGG	1 cut(s)	172
PspEI	GGTNACC	1 cut(s)	439
PspGI	CCWGG	1 cut(s)	172
PvuII	CAGCTG	1 cut(s)	791
RsaI	GTAC	2 cut(s)	405, 833
RsaNI	GTAC	2 cut(s)	404, 832
RseI	CAYNNNNRTG	7 cut(s)	45, 236, 267, 321, 327, 431, 536
SaqAI	TTAA	5 cut(s)	71, 183, 228, 596, 695
SatI	GCNGC	3 cut(s)	542, 675, 792
Sau3AI	GATC	8 cut(s)	259, 286, 304, 313, 334, 477, 484, 585
ScrFI	CCNGG	1 cut(s)	174
SduI	GDGCHC	3 cut(s)	94, 191, 575
SfaNI	GCATC	2 cut(s)	49, 616
SmiMI	CAYNNNNRTG	7 cut(s)	45, 236, 267, 321, 327, 431, 536
SmlI	CTYRAG	2 cut(s)	70, 602
SmoI	CTYRAG	2 cut(s)	70, 602
SphI	GCATGC	1 cut(s)	541
Sse9I	AATT	5 cut(s)	17, 135, 549, 735, 784
SsiI	CCGC	4 cut(s)	242, 444, 544, 766
SspI	AATATT	1 cut(s)	504
SspMI	CTAG	2 cut(s)	86, 221
StyD4I	CCNGG	1 cut(s)	172
StyI	CCWWGG	5 cut(s)	85, 237, 268, 280, 385
TaaI	ACNGT	1 cut(s)	214
TaqI	TCGA	1 cut(s)	588
TasI	AATT	5 cut(s)	17, 135, 549, 735, 784
TatI	WGTACW	1 cut(s)	403
TfiI	GAWTC	1 cut(s)	725
Tru1I	TTAA	5 cut(s)	71, 183, 228, 596, 695
Tru9I	TTAA	5 cut(s)	71, 183, 228, 596, 695
TscAI	CASTG	2 cut(s)	127, 780
TseFI	GTSAC	1 cut(s)	439
TseI	GCWGC	3 cut(s)	541, 674, 791
Tsp45I	GTSAC	1 cut(s)	439
TspDTI	ATGAA	4 cut(s)	156, 389, 392, 660
TspRI	CASTG	2 cut(s)	127, 780
Van91I	CCANNNNNTGG	1 cut(s)	718
Vha464I	CTTAAG	1 cut(s)	70
XceI	RCATGY	1 cut(s)	541
XmaJI	CCTAGG	1 cut(s)	85
XspI	CTAG	2 cut(s)	86, 221

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.