Rmu_sc0001715.1_g000028

DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001715.1
Physical Location & Seq
Forward (+)
90496 .. 92274
1779 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001715.1_g000028.1.cds

Sequence Viewer

Length: 384 bp
atgaccagtcaaacaaggggaatgcagaatggcgaattgaagaacaagaggcttcacttggctggtgagcttctagagagagagctgaaggcacacataggacatgcagggaggtgcatggcaaaagctttgcagagagacctttgtggttaccgtgttgtccgcccggttgagcaacatatagatgctacaatagtaactaatggcatctccagagcattctcaacaggagcgttgcgtcatcctttcaagactatggagaggatatctggtgtggtggtaaatgttgggaaaacaaatccactgcaaacaatggtagatatgaggaagacacgcctccaagttcaatacatggggaaggttcgagatgccagatatccgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component

Protein Analysis

127

Amino Acids

14.34

Weight (kDa)

10.55

Isoelectric Point (pI)

26.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 163
AcuI CTGAAG 1 cut(s) 107
AgsI TTSAA 3 cut(s) 40, 250, 347
AluBI AGCT 3 cut(s) 70, 85, 128
AluI AGCT 3 cut(s) 70, 85, 128
Alw26I GTCTC 1 cut(s) 132
AsuC2I CCSGG 1 cut(s) 167
AsuHPI GGTGA 1 cut(s) 77
BbsI GAAGAC 1 cut(s) 335
BcnI CCSGG 1 cut(s) 167
BcoDI GTCTC 1 cut(s) 132
BfaI CTAG 1 cut(s) 74
Bme1390I CCNGG 1 cut(s) 167
BmrFI CCNGG 1 cut(s) 167
BmsI GCATC 3 cut(s) 175, 216, 358
BpiI GAAGAC 1 cut(s) 335
BpmI CTGGAG 1 cut(s) 196
BpuMI CCSGG 1 cut(s) 167
BsaI GGTCTC 1 cut(s) 132
Bse1I ACTGG 1 cut(s) 6
BseGI GGATG 1 cut(s) 241
BseNI ACTGG 1 cut(s) 6
BsiSI CCGG 1 cut(s) 167
BsmAI GTCTC 1 cut(s) 132
BsmI GAATGC 2 cut(s) 27, 218
Bso31I GGTCTC 1 cut(s) 132
BspACI CCGC 1 cut(s) 163
BspTNI GGTCTC 1 cut(s) 132
BsrI ACTGG 1 cut(s) 6
Bst4CI ACNGT 1 cut(s) 155
BstEII GGTNACC 1 cut(s) 149
BstF5I GGATG 1 cut(s) 241
BstMAI GTCTC 1 cut(s) 132
BstNSI RCATGY 1 cut(s) 107
BstPI GGTNACC 1 cut(s) 149
BstSCI CCNGG 1 cut(s) 165
BstV2I GAAGAC 1 cut(s) 335
BtsCI GGATG 1 cut(s) 241
BtsI GCAGTG 1 cut(s) 302
BtsIMutI CAGTG 1 cut(s) 302
CseI GACGC 1 cut(s) 227
CviAII CATG 3 cut(s) 104, 118, 352
CviJI RGCY 5 cut(s) 52, 62, 70, 85, 128
CviKI_1 RGCY 5 cut(s) 52, 62, 70, 85, 128
EciI GGCGGA 1 cut(s) 152
Eco31I GGTCTC 1 cut(s) 132
Eco32I GATATC 2 cut(s) 267, 377
Eco57I CTGAAG 1 cut(s) 107
Eco91I GGTNACC 1 cut(s) 149
EcoO65I GGTNACC 1 cut(s) 149
EcoRV GATATC 2 cut(s) 267, 377
FaeI CATG 3 cut(s) 107, 121, 355
FaiI YATR 8 cut(s) 98, 105, 119, 180, 182, 257, 323, 353
FatI CATG 3 cut(s) 103, 117, 351
FokI GGATG 1 cut(s) 228
FspBI CTAG 1 cut(s) 74
GsuI CTGGAG 1 cut(s) 196
HapII CCGG 1 cut(s) 167
HgaI GACGC 1 cut(s) 227
Hin1II CATG 3 cut(s) 107, 121, 355
HindIII AAGCTT 1 cut(s) 126
HpaII CCGG 1 cut(s) 167
HphI GGTGA 1 cut(s) 77
Hpy188III TCNNGA 4 cut(s) 74, 213, 250, 365
HpyAV CCTTC 2 cut(s) 82, 352
HpyCH4III ACNGT 1 cut(s) 155
HpyCH4V TGCA 5 cut(s) 25, 107, 117, 133, 307
Hsp92II CATG 3 cut(s) 107, 121, 355
LmnI GCTCC 1 cut(s) 230
LpnPI CCDG 7 cut(s) 19, 48, 93, 180, 213, 226, 255
LweI GCATC 3 cut(s) 175, 216, 358
MaeI CTAG 1 cut(s) 74
MaeIII GTNAC 2 cut(s) 149, 196
MboII GAAGA 2 cut(s) 52, 340
MluCI AATT 1 cut(s) 35
MnlI CCTC 5 cut(s) 42, 105, 255, 318, 347
MslI CAYNNNNRTG 1 cut(s) 183
MspI CCGG 1 cut(s) 167
MspR9I CCNGG 1 cut(s) 167
Mva1269I GAATGC 2 cut(s) 27, 218
NciI CCSGG 1 cut(s) 167
NlaIII CATG 3 cut(s) 107, 121, 355
NspI RCATGY 1 cut(s) 107
PctI GAATGC 2 cut(s) 27, 218
PspEI GGTNACC 1 cut(s) 149
RseI CAYNNNNRTG 1 cut(s) 183
ScrFI CCNGG 1 cut(s) 167
SetI ASST 6 cut(s) 72, 87, 116, 130, 144, 363
SfaNI GCATC 3 cut(s) 175, 216, 358
SmiMI CAYNNNNRTG 1 cut(s) 183
Sse9I AATT 1 cut(s) 35
SsiI CCGC 1 cut(s) 163
SspMI CTAG 1 cut(s) 74
StyD4I CCNGG 1 cut(s) 165
TaaI ACNGT 1 cut(s) 155
TaqI TCGA 1 cut(s) 364
TasI AATT 1 cut(s) 35
TscAI CASTG 1 cut(s) 309
TspGWI ACGGA 1 cut(s) 369
TspRI CASTG 1 cut(s) 309
XbaI TCTAGA 1 cut(s) 73
XceI RCATGY 1 cut(s) 107
XspI CTAG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.