Rmu_sc0039596.1_g000001

DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0039596.1
Physical Location & Seq
Forward (+)
1 .. 396
396 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0039596.1_g000001.1.cds

Sequence Viewer

Length: 396 bp
cttttacagaccttcagaggccacaggaaatgtgacaacagagaagaattgaagaacaagaggtttcacttggctggtgagcgtctagagcgagagctgaaggcacacgtaggacatgcaggaaggcgcatggcaaaggctctgcagagagacctttgtggtgaccgtgttgtccgcctggttgagcaatatctaaatgctacagtagtaactaatggcatctccagagcattctcaactggagcgtggtgtcatcctttcaagaggatggagaggatgtctggtgtggtggtaaatgttgggaaaacaattccactgcaaacaatggtagatatgaggaagacacgcctccaagttcaatacacggggaagcttggagatgccagatatctgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component

Protein Analysis

131

Amino Acids

15.09

Weight (kDa)

10.57

Isoelectric Point (pI)

28.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 170
AciI CCGC 1 cut(s) 175
AcuI CTGAAG 1 cut(s) 119
AflIII ACRYGT 1 cut(s) 106
AgsI TTSAA 3 cut(s) 52, 262, 359
AjnI CCWGG 1 cut(s) 177
AluBI AGCT 2 cut(s) 97, 373
AluI AGCT 2 cut(s) 97, 373
Alw26I GTCTC 1 cut(s) 144
AoxI GGCC 1 cut(s) 19
AspLEI GCGC 1 cut(s) 129
AsuHPI GGTGA 2 cut(s) 89, 173
BbsI GAAGAC 1 cut(s) 347
BccI CCATC 1 cut(s) 262
BciT130I CCWGG 1 cut(s) 179
BcoDI GTCTC 1 cut(s) 144
BfaI CTAG 1 cut(s) 86
BfmI CTRYAG 2 cut(s) 143, 201
Bme1390I CCNGG 1 cut(s) 179
BmrFI CCNGG 1 cut(s) 179
BmsI GCATC 2 cut(s) 228, 370
BpiI GAAGAC 1 cut(s) 347
BpmI CTGGAG 2 cut(s) 208, 261
BsaAI YACGTR 1 cut(s) 109
BsaI GGTCTC 1 cut(s) 144
BsaXI ACNNNNNCTCC 2 cut(s) 263, 293
Bse1I ACTGG 1 cut(s) 244
BseBI CCWGG 1 cut(s) 179
BseGI GGATG 3 cut(s) 253, 273, 282
BseNI ACTGG 1 cut(s) 244
BshFI GGCC 1 cut(s) 21
BsmAI GTCTC 1 cut(s) 144
BsmI GAATGC 1 cut(s) 230
BsnI GGCC 1 cut(s) 21
Bso31I GGTCTC 1 cut(s) 144
BspACI CCGC 1 cut(s) 175
BspANI GGCC 1 cut(s) 21
BspMAI CTGCAG 1 cut(s) 147
BspTNI GGTCTC 1 cut(s) 144
BsrI ACTGG 1 cut(s) 244
Bst2UI CCWGG 1 cut(s) 179
Bst4CI ACNGT 2 cut(s) 167, 205
BstBAI YACGTR 1 cut(s) 109
BstEII GGTNACC 1 cut(s) 161
BstF5I GGATG 3 cut(s) 253, 273, 282
BstHHI GCGC 1 cut(s) 129
BstMAI GTCTC 1 cut(s) 144
BstMWI GCNNNNNNNGC 1 cut(s) 88
BstNI CCWGG 1 cut(s) 179
BstNSI RCATGY 1 cut(s) 119
BstPI GGTNACC 1 cut(s) 161
BstSCI CCNGG 1 cut(s) 177
BstSFI CTRYAG 2 cut(s) 143, 201
BstV2I GAAGAC 1 cut(s) 347
BsuRI GGCC 1 cut(s) 21
BtsCI GGATG 3 cut(s) 253, 273, 282
BtsI GCAGTG 1 cut(s) 314
BtsIMutI CAGTG 1 cut(s) 314
CfoI GCGC 1 cut(s) 129
CseI GACGC 1 cut(s) 71
CviAII CATG 2 cut(s) 116, 130
CviJI RGCY 5 cut(s) 21, 74, 97, 140, 373
CviKI_1 RGCY 5 cut(s) 21, 74, 97, 140, 373
DrdI GACNNNNNNGTC 1 cut(s) 170
DseDI GACNNNNNNGTC 1 cut(s) 170
EciI GGCGGA 1 cut(s) 164
Eco31I GGTCTC 1 cut(s) 144
Eco32I GATATC 1 cut(s) 389
Eco57I CTGAAG 1 cut(s) 119
Eco91I GGTNACC 1 cut(s) 161
EcoO65I GGTNACC 1 cut(s) 161
EcoRII CCWGG 1 cut(s) 177
EcoRV GATATC 1 cut(s) 389
FaeI CATG 2 cut(s) 119, 133
FaiI YATR 3 cut(s) 117, 131, 335
FatI CATG 2 cut(s) 115, 129
FokI GGATG 3 cut(s) 240, 280, 289
FspBI CTAG 1 cut(s) 86
GlaI GCGC 1 cut(s) 128
GsuI CTGGAG 2 cut(s) 208, 261
HaeIII GGCC 1 cut(s) 21
HgaI GACGC 1 cut(s) 71
HhaI GCGC 1 cut(s) 129
Hin1II CATG 2 cut(s) 119, 133
Hin6I GCGC 1 cut(s) 127
HinP1I GCGC 1 cut(s) 127
HindIII AAGCTT 1 cut(s) 371
HphI GGTGA 2 cut(s) 89, 173
Hpy188I TCNGA 1 cut(s) 17
Hpy188III TCNNGA 3 cut(s) 86, 225, 262
HpyAV CCTTC 3 cut(s) 22, 94, 117
HpyCH4III ACNGT 2 cut(s) 167, 205
HpyCH4IV ACGT 1 cut(s) 108
HpyCH4V TGCA 3 cut(s) 119, 145, 319
HpyF10VI GCNNNNNNNGC 1 cut(s) 88
HpySE526I ACGT 1 cut(s) 108
Hsp92II CATG 2 cut(s) 119, 133
HspAI GCGC 1 cut(s) 127
LmnI GCTCC 1 cut(s) 242
LpnPI CCDG 8 cut(s) 10, 60, 105, 164, 191, 225, 238, 267
LweI GCATC 2 cut(s) 228, 370
MaeI CTAG 1 cut(s) 86
MaeII ACGT 1 cut(s) 108
MaeIII GTNAC 3 cut(s) 32, 161, 208
MboII GAAGA 3 cut(s) 56, 64, 352
MluCI AATT 2 cut(s) 47, 309
MnlI CCTC 6 cut(s) 11, 54, 258, 267, 330, 359
MspR9I CCNGG 1 cut(s) 179
Mva1269I GAATGC 1 cut(s) 230
MvaI CCWGG 1 cut(s) 179
MwoI GCNNNNNNNGC 1 cut(s) 88
NlaIII CATG 2 cut(s) 119, 133
NmuCI GTSAC 2 cut(s) 32, 161
NspI RCATGY 1 cut(s) 119
PctI GAATGC 1 cut(s) 230
Ppu21I YACGTR 1 cut(s) 109
Psp6I CCWGG 1 cut(s) 177
PspEI GGTNACC 1 cut(s) 161
PspGI CCWGG 1 cut(s) 177
PstI CTGCAG 1 cut(s) 147
ScrFI CCNGG 1 cut(s) 179
SetI ASST 6 cut(s) 14, 65, 99, 111, 156, 375
SfaNI GCATC 2 cut(s) 228, 370
SfcI CTRYAG 2 cut(s) 143, 201
Sse9I AATT 2 cut(s) 47, 309
SsiI CCGC 1 cut(s) 175
SspMI CTAG 1 cut(s) 86
StyD4I CCNGG 1 cut(s) 177
TaaI ACNGT 2 cut(s) 167, 205
TaiI ACGT 1 cut(s) 111
TasI AATT 2 cut(s) 47, 309
TscAI CASTG 1 cut(s) 321
TseFI GTSAC 2 cut(s) 32, 161
Tsp45I GTSAC 2 cut(s) 32, 161
TspRI CASTG 1 cut(s) 321
XbaI TCTAGA 1 cut(s) 85
XceI RCATGY 1 cut(s) 119
XspI CTAG 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.