Rmu_sc0001827.1_g000003

acid phosphatase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001827.1
Physical Location & Seq
Forward (+)
11282 .. 11949
668 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001827.1_g000003.1.cds

Sequence Viewer

Length: 486 bp
atgttgagctgcataacattagagagttccaagtggtgccttggaaaatatgttacttcgactcagtacaaagtggactcagacagggctattgaggagtccattgtgtatctaagaactagctgtaatttgaagaatgatggtacaggtgcatggatttttgacattgatgatacactgctctctattgtgccttactacaagggacatcatttcgggggtgagaagttgaacctgagtactttggaggagtggatgagccatggcaaggcacctactctggatcactcactcaaactattcaatgagatcaaacccagagggctgctgatcattctggtttcttcaaggagggagcatcttaaatcagccacaatgtacaaccttctccatgttggctcttatggatggacaagtctcattttaaggtcagttcttctctcactcaatcacataatatatagagaggtcaaatcttgtgcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

161

Amino Acids

18.31

Weight (kDa)

8.32

Isoelectric Point (pI)

37.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 36, 271
AclWI GGATC 1 cut(s) 291
AfaI GTAC 4 cut(s) 68, 145, 241, 380
AfiI CCNNNNNNNGG 1 cut(s) 268
AgsI TTSAA 4 cut(s) 133, 232, 304, 348
AluBI AGCT 2 cut(s) 9, 123
AluI AGCT 2 cut(s) 9, 123
Alw26I GTCTC 1 cut(s) 422
AlwI GGATC 1 cut(s) 291
ApeKI GCWGC 2 cut(s) 9, 325
AsuHPI GGTGA 1 cut(s) 233
BanI GGYRCC 2 cut(s) 36, 271
BbvI GCAGC 1 cut(s) 312
BccI CCATC 2 cut(s) 134, 402
BclI TGATCA 1 cut(s) 330
BcoDI GTCTC 1 cut(s) 422
BfaI CTAG 1 cut(s) 120
BisI GCNGC 2 cut(s) 10, 326
BlsI GCNGC 2 cut(s) 11, 327
BmcAI AGTACT 1 cut(s) 241
BmiI GGNNCC 2 cut(s) 38, 273
BmsI GCATC 1 cut(s) 367
BsaJI CCNNGG 2 cut(s) 40, 262
Bsc4I CCNNNNNNNGG 1 cut(s) 268
BseDI CCNNGG 2 cut(s) 40, 262
BseGI GGATG 2 cut(s) 261, 413
BseLI CCNNNNNNNGG 1 cut(s) 268
BseMII CTCAG 3 cut(s) 77, 93, 227
BseRI GAGGAG 2 cut(s) 110, 263
BseXI GCAGC 1 cut(s) 312
BshNI GGYRCC 2 cut(s) 36, 271
BslFI GGGAC 1 cut(s) 219
BslI CCNNNNNNNGG 1 cut(s) 268
BsmAI GTCTC 1 cut(s) 422
BsmFI GGGAC 1 cut(s) 219
Bsp1407I TGTACA 1 cut(s) 378
Bsp143I GATC 3 cut(s) 283, 309, 330
Bsp19I CCATGG 1 cut(s) 262
BspCNI CTCAG 3 cut(s) 76, 92, 228
BspLI GGNNCC 2 cut(s) 38, 273
BspPI GGATC 1 cut(s) 291
BspT107I GGYRCC 2 cut(s) 36, 271
BsrGI TGTACA 1 cut(s) 378
BssECI CCNNGG 2 cut(s) 40, 262
BssMI GATC 3 cut(s) 283, 309, 330
BssT1I CCWWGG 2 cut(s) 40, 262
BstAUI TGTACA 1 cut(s) 378
BstDEI CTNAG 4 cut(s) 63, 79, 113, 236
BstDSI CCRYGG 1 cut(s) 262
BstF5I GGATG 2 cut(s) 261, 413
BstKTI GATC 3 cut(s) 286, 312, 333
BstMAI GTCTC 1 cut(s) 422
BstMBI GATC 3 cut(s) 283, 309, 330
BstV1I GCAGC 1 cut(s) 312
BtgI CCRYGG 1 cut(s) 262
BtsCI GGATG 2 cut(s) 261, 413
BtsI GCAGTG 1 cut(s) 176
BtsIMutI CAGTG 1 cut(s) 176
Csp6I GTAC 4 cut(s) 67, 144, 240, 379
CviAII CATG 3 cut(s) 153, 263, 392
CviJI RGCY 7 cut(s) 9, 89, 123, 261, 325, 371, 399
CviKI_1 RGCY 7 cut(s) 9, 89, 123, 261, 325, 371, 399
CviQI GTAC 4 cut(s) 67, 144, 240, 379
DdeI CTNAG 4 cut(s) 63, 79, 113, 236
DpnI GATC 3 cut(s) 285, 311, 332
DpnII GATC 3 cut(s) 283, 309, 330
Eco130I CCWWGG 2 cut(s) 40, 262
EcoT14I CCWWGG 2 cut(s) 40, 262
ErhI CCWWGG 2 cut(s) 40, 262
FaeI CATG 3 cut(s) 156, 266, 395
FaiI YATR 9 cut(s) 14, 51, 154, 264, 393, 405, 455, 460, 462
FaqI GGGAC 1 cut(s) 219
FatI CATG 3 cut(s) 152, 262, 391
FbaI TGATCA 1 cut(s) 330
Fnu4HI GCNGC 2 cut(s) 10, 326
FokI GGATG 2 cut(s) 268, 420
Fsp4HI GCNGC 2 cut(s) 10, 326
FspBI CTAG 1 cut(s) 120
GluI GCNGC 2 cut(s) 10, 326
Hin1II CATG 3 cut(s) 156, 266, 395
HinfI GANTC 3 cut(s) 61, 77, 98
HphI GGTGA 1 cut(s) 233
Hpy166II GTNNAC 1 cut(s) 76
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 1 cut(s) 281
Hpy8I GTNNAC 1 cut(s) 76
HpyAV CCTTC 1 cut(s) 395
HpyCH4V TGCA 2 cut(s) 12, 152
HpyF3I CTNAG 4 cut(s) 63, 79, 113, 236
Hsp92II CATG 3 cut(s) 156, 266, 395
Ksp22I TGATCA 1 cut(s) 330
Kzo9I GATC 3 cut(s) 283, 309, 330
LmnI GCTCC 1 cut(s) 355
LpnPI CCDG 6 cut(s) 70, 132, 248, 266, 323, 331
Lsp1109I GCAGC 1 cut(s) 312
LweI GCATC 1 cut(s) 367
MaeI CTAG 1 cut(s) 120
MaeIII GTNAC 1 cut(s) 52
MalI GATC 3 cut(s) 285, 311, 332
MboI GATC 3 cut(s) 283, 309, 330
MboII GAAGA 3 cut(s) 145, 336, 428
MluCI AATT 1 cut(s) 127
MlyI GAGTC 3 cut(s) 55, 71, 107
MnlI CCTC 5 cut(s) 88, 241, 314, 345, 460
MseI TTAA 2 cut(s) 363, 425
NcoI CCATGG 1 cut(s) 262
NdeII GATC 3 cut(s) 283, 309, 330
NlaIII CATG 3 cut(s) 156, 266, 395
NlaIV GGNNCC 2 cut(s) 38, 273
PkrI GCNGC 2 cut(s) 11, 327
PleI GAGTC 3 cut(s) 55, 71, 106
PpsI GAGTC 3 cut(s) 55, 71, 106
PspN4I GGNNCC 2 cut(s) 38, 273
RsaI GTAC 4 cut(s) 68, 145, 241, 380
RsaNI GTAC 4 cut(s) 67, 144, 240, 379
SaqAI TTAA 2 cut(s) 363, 425
SatI GCNGC 2 cut(s) 10, 326
Sau3AI GATC 3 cut(s) 283, 309, 330
ScaI AGTACT 1 cut(s) 241
SchI GAGTC 3 cut(s) 55, 71, 107
SetI ASST 8 cut(s) 11, 125, 151, 237, 277, 387, 431, 471
SfaNI GCATC 1 cut(s) 367
Sse9I AATT 1 cut(s) 127
SspMI CTAG 1 cut(s) 120
StyI CCWWGG 2 cut(s) 40, 262
TaqI TCGA 1 cut(s) 59
TasI AATT 1 cut(s) 127
TatI WGTACW 3 cut(s) 66, 239, 378
Tru1I TTAA 2 cut(s) 363, 425
Tru9I TTAA 2 cut(s) 363, 425
TscAI CASTG 1 cut(s) 183
TseI GCWGC 2 cut(s) 9, 325
TspRI CASTG 1 cut(s) 183
XspI CTAG 1 cut(s) 120
ZrmI AGTACT 1 cut(s) 241
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.