Rmu_sc0002016.1_g000030

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002016.1
Physical Location & Seq
Reverse (-)
93216 .. 94164
949 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002016.1_g000030.1.cds

Sequence Viewer

Length: 630 bp
atgaatgtgttggcctcggaatgcagtagtggttgtgagtccggttggactctgtacttagagcaatcttttgtttctcaacatccgagtggttcacatagaggtaatagtaatggtttttgtgaggagtataaggaaaaaagaattagctatagtaataaggatgaagaagaagaagaagaccagtcaatggtttctgatgcttcttctgggcctcctcatttcaatgaagatgaggtttacattgatgaaaacaataatgggtatttttgtcctccatccaaagatgttagaacattgaagtttggaggtaaaaagcagaagatcaaagaaaagggtagatgtggtgttcaagatcaacagcaacagcaaccatcttttctagatgacactgctagctccccttttttcaacatttccaagaacaatttgatggtgtccaataatcaggcttcaggtgatagtgtcctggatttctcacaaggtttctcatcaactcattttcaggggagatctgcataccaagaccactatggtttcttacaatctactctacctggaaatccacttcaggatcaaaaccagtggtttgaagggaatgagataacaagatcttcatatcatcaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

209

Amino Acids

23.55

Weight (kDa)

4.79

Isoelectric Point (pI)

62.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 190
AclWI GGATC 1 cut(s) 582
AcuI CTGAAG 2 cut(s) 438, 554
AfaI GTAC 1 cut(s) 56
AfiI CCNNNNNNNGG 1 cut(s) 190
AgsI TTSAA 5 cut(s) 226, 301, 353, 412, 593
AjnI CCWGG 2 cut(s) 468, 556
AluBI AGCT 2 cut(s) 150, 399
AluI AGCT 2 cut(s) 150, 399
AlwI GGATC 1 cut(s) 582
AoxI GGCC 2 cut(s) 12, 212
AspS9I GGNCC 1 cut(s) 212
AsuHPI GGTGA 1 cut(s) 470
AsuNHI GCTAGC 1 cut(s) 395
BbsI GAAGAC 1 cut(s) 186
BccI CCATC 3 cut(s) 286, 382, 427
BciT130I CCWGG 2 cut(s) 470, 558
BfaI CTAG 2 cut(s) 383, 396
BfmI CTRYAG 1 cut(s) 151
BglII AGATCT 2 cut(s) 512, 611
Bme1390I CCNGG 2 cut(s) 470, 558
BmgT120I GGNCC 1 cut(s) 212
BmrFI CCNGG 2 cut(s) 470, 558
BmsI GCATC 1 cut(s) 190
BmtI GCTAGC 1 cut(s) 399
BpiI GAAGAC 1 cut(s) 186
BsaJI CCNNGG 1 cut(s) 15
BsaWI WCCGGW 1 cut(s) 41
Bsc4I CCNNNNNNNGG 1 cut(s) 190
Bse1I ACTGG 2 cut(s) 184, 583
BseBI CCWGG 2 cut(s) 470, 558
BseDI CCNNGG 1 cut(s) 15
BseGI GGATG 3 cut(s) 82, 169, 278
BseLI CCNNNNNNNGG 1 cut(s) 190
BseNI ACTGG 2 cut(s) 184, 583
BseRI GAGGAG 2 cut(s) 140, 207
BshFI GGCC 2 cut(s) 14, 214
BsiSI CCGG 1 cut(s) 42
BslI CCNNNNNNNGG 1 cut(s) 190
BsmI GAATGC 1 cut(s) 26
BsnI GGCC 2 cut(s) 14, 214
Bsp143I GATC 5 cut(s) 324, 355, 512, 574, 611
BspANI GGCC 2 cut(s) 14, 214
BspOI GCTAGC 1 cut(s) 399
BspPI GGATC 1 cut(s) 582
BsrI ACTGG 2 cut(s) 184, 583
BssECI CCNNGG 1 cut(s) 15
BssMI GATC 5 cut(s) 324, 355, 512, 574, 611
Bst2UI CCWGG 2 cut(s) 470, 558
BstC8I GCNNGC 1 cut(s) 397
BstDEI CTNAG 1 cut(s) 58
BstF5I GGATG 3 cut(s) 82, 169, 278
BstKTI GATC 5 cut(s) 327, 358, 515, 577, 614
BstMBI GATC 5 cut(s) 324, 355, 512, 574, 611
BstNI CCWGG 2 cut(s) 470, 558
BstSCI CCNGG 2 cut(s) 468, 556
BstSFI CTRYAG 1 cut(s) 151
BstV2I GAAGAC 1 cut(s) 186
BstX2I RGATCY 2 cut(s) 512, 611
BstYI RGATCY 2 cut(s) 512, 611
BsuRI GGCC 2 cut(s) 14, 214
BtsCI GGATG 3 cut(s) 82, 169, 278
BtsI GCAGTG 1 cut(s) 390
BtsIMutI CAGTG 2 cut(s) 390, 590
Cac8I GCNNGC 1 cut(s) 397
Cfr13I GGNCC 1 cut(s) 212
Csp6I GTAC 1 cut(s) 55
CspCI CAANNNNNGTGG 2 cut(s) 566, 601
CviJI RGCY 5 cut(s) 14, 150, 214, 399, 452
CviKI_1 RGCY 5 cut(s) 14, 150, 214, 399, 452
CviQI GTAC 1 cut(s) 55
DdeI CTNAG 1 cut(s) 58
DpnI GATC 5 cut(s) 326, 357, 514, 576, 613
DpnII GATC 5 cut(s) 324, 355, 512, 574, 611
Eco57I CTGAAG 2 cut(s) 438, 554
EcoRII CCWGG 2 cut(s) 468, 556
FaiI YATR 6 cut(s) 99, 132, 153, 520, 534, 619
FokI GGATG 3 cut(s) 69, 176, 265
FspBI CTAG 2 cut(s) 383, 396
HaeIII GGCC 2 cut(s) 14, 214
HapII CCGG 1 cut(s) 42
HinfI GANTC 2 cut(s) 38, 49
HpaII CCGG 1 cut(s) 42
HphI GGTGA 1 cut(s) 470
Hpy166II GTNNAC 2 cut(s) 95, 241
Hpy188I TCNGA 3 cut(s) 19, 87, 199
Hpy188III TCNNGA 3 cut(s) 353, 383, 572
Hpy8I GTNNAC 2 cut(s) 95, 241
HpyAV CCTTC 1 cut(s) 587
HpyCH4V TGCA 2 cut(s) 24, 518
HpyF3I CTNAG 1 cut(s) 58
Kzo9I GATC 5 cut(s) 324, 355, 512, 574, 611
LmnI GCTCC 1 cut(s) 404
LweI GCATC 1 cut(s) 190
MaeI CTAG 2 cut(s) 383, 396
MalI GATC 5 cut(s) 326, 357, 514, 576, 613
MboI GATC 5 cut(s) 324, 355, 512, 574, 611
MboII GAAGA 9 cut(s) 179, 182, 185, 188, 191, 198, 242, 334, 606
MflI RGATCY 2 cut(s) 512, 611
MluCI AATT 2 cut(s) 144, 427
MlyI GAGTC 2 cut(s) 43, 47
MmeI TCCRAC 1 cut(s) 26
MnlI CCTC 8 cut(s) 25, 95, 118, 225, 228, 229, 285, 302
MslI CAYNNNNRTG 2 cut(s) 87, 225
MspI CCGG 1 cut(s) 42
MspR9I CCNGG 2 cut(s) 470, 558
Mva1269I GAATGC 1 cut(s) 26
MvaI CCWGG 2 cut(s) 470, 558
NdeII GATC 5 cut(s) 324, 355, 512, 574, 611
NheI GCTAGC 1 cut(s) 395
PctI GAATGC 1 cut(s) 26
PflMI CCANNNNNTGG 1 cut(s) 190
PfoI TCCNGGA 1 cut(s) 468
PleI GAGTC 2 cut(s) 43, 46
PpsI GAGTC 2 cut(s) 43, 46
Psp6I CCWGG 2 cut(s) 468, 556
PspGI CCWGG 2 cut(s) 468, 556
PspPI GGNCC 1 cut(s) 212
PsuI RGATCY 2 cut(s) 512, 611
RsaI GTAC 1 cut(s) 56
RsaNI GTAC 1 cut(s) 55
RseI CAYNNNNRTG 2 cut(s) 87, 225
Sau3AI GATC 5 cut(s) 324, 355, 512, 574, 611
Sau96I GGNCC 1 cut(s) 212
SchI GAGTC 2 cut(s) 43, 47
ScrFI CCNGG 2 cut(s) 470, 558
SetI ASST 8 cut(s) 106, 152, 240, 313, 401, 460, 487, 559
SfaNI GCATC 1 cut(s) 190
SfcI CTRYAG 1 cut(s) 151
SmiMI CAYNNNNRTG 2 cut(s) 87, 225
Sse9I AATT 2 cut(s) 144, 427
SspMI CTAG 2 cut(s) 383, 396
StyD4I CCNGG 2 cut(s) 468, 556
TasI AATT 2 cut(s) 144, 427
TatI WGTACW 1 cut(s) 54
TscAI CASTG 2 cut(s) 397, 590
TspDTI ATGAA 5 cut(s) 17, 180, 243, 264, 606
TspRI CASTG 2 cut(s) 397, 590
Van91I CCANNNNNTGG 1 cut(s) 190
XbaI TCTAGA 1 cut(s) 382
XcmI CCANNNNNNNNNTGG 1 cut(s) 530
XspI CTAG 2 cut(s) 383, 396
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.