Rh6DG488900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0003210
Physical Location & Seq
Forward (+)
64960182 .. 64962435
2254 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG488900.1

Sequence Viewer

Length: 411 bp
ATGAACATATCACAATCACAATACAATAGTGGGTGTGAATCTGGGTGGACACATTACCTAGATCAGTCGTATCTTTCTGGAAGCCATGGGATTCAAAAAGGTGATGATTATGTAGGAACAAAACCAGAATTTGAAGAGGAAGAAGAGGAGGAGGATCTATCCATGGTGTCTGATGCTTCTTCTGGACCTCCACATTACCAAGAATTATATGAAGATGGGTGTTCGTTTTCGGTTAATTCTTCGGCTTCCAAATTAGGCAAGAAAAGCAAGAAAAAGAAGAGCAAAGAAAGTAGAGGCAAAGAACAACACCACCATCTTGATGACACTGCTAGCTCCTCAGTCTTCAACTACTACTCCAAGGCAAAATCAAAGTCTCATACAACATGCATTGATAGTTATAAAGATTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

136

Amino Acids

15.3

Weight (kDa)

5.44

Isoelectric Point (pI)

54.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 399
AclWI GGATC 1 cut(s) 162
AcsI RAATTY 1 cut(s) 128
AgsI TTSAA 3 cut(s) 95, 134, 346
AluBI AGCT 1 cut(s) 333
AluI AGCT 1 cut(s) 333
Alw26I GTCTC 1 cut(s) 378
AlwI GGATC 1 cut(s) 162
ApoI RAATTY 1 cut(s) 128
ArsI GACNNNNNNTTYG 2 cut(s) 356, 388
AspS9I GGNCC 1 cut(s) 185
AsuHPI GGTGA 1 cut(s) 113
AsuNHI GCTAGC 1 cut(s) 329
AvaII GGWCC 1 cut(s) 185
BbsI GAAGAC 1 cut(s) 334
BccI CCATC 2 cut(s) 209, 321
BcoDI GTCTC 1 cut(s) 378
BfaI CTAG 2 cut(s) 59, 330
Bme18I GGWCC 1 cut(s) 185
BmgT120I GGNCC 1 cut(s) 185
BmsI GCATC 1 cut(s) 163
BmtI GCTAGC 1 cut(s) 333
BpiI GAAGAC 1 cut(s) 334
BsaJI CCNNGG 3 cut(s) 85, 162, 357
BsaXI ACNNNNNCTCC 2 cut(s) 338, 368
BseDI CCNNGG 3 cut(s) 85, 162, 357
BseMII CTCAG 1 cut(s) 351
BseRI GAGGAG 3 cut(s) 161, 164, 325
BsmAI GTCTC 1 cut(s) 378
Bsp143I GATC 2 cut(s) 61, 154
Bsp19I CCATGG 2 cut(s) 85, 162
BspCNI CTCAG 1 cut(s) 350
BspOI GCTAGC 1 cut(s) 333
BspPI GGATC 1 cut(s) 162
BspQI GCTCTTC 1 cut(s) 272
BssECI CCNNGG 3 cut(s) 85, 162, 357
BssMI GATC 2 cut(s) 61, 154
BssT1I CCWWGG 3 cut(s) 85, 162, 357
Bst6I CTCTTC 3 cut(s) 129, 138, 272
BstC8I GCNNGC 1 cut(s) 331
BstDEI CTNAG 1 cut(s) 337
BstDSI CCRYGG 2 cut(s) 85, 162
BstKTI GATC 2 cut(s) 64, 157
BstMAI GTCTC 1 cut(s) 378
BstMBI GATC 2 cut(s) 61, 154
BstMWI GCNNNNNNNGC 1 cut(s) 264
BstNSI RCATGY 1 cut(s) 387
BstV2I GAAGAC 1 cut(s) 334
BstX2I RGATCY 1 cut(s) 154
BstYI RGATCY 1 cut(s) 154
BtgI CCRYGG 2 cut(s) 85, 162
BtsI GCAGTG 1 cut(s) 324
BtsIMutI CAGTG 1 cut(s) 324
Cac8I GCNNGC 1 cut(s) 331
Cfr13I GGNCC 1 cut(s) 185
CviAII CATG 3 cut(s) 86, 163, 384
CviJI RGCY 3 cut(s) 84, 245, 333
CviKI_1 RGCY 3 cut(s) 84, 245, 333
DdeI CTNAG 1 cut(s) 337
DpnI GATC 2 cut(s) 63, 156
DpnII GATC 2 cut(s) 61, 154
Eam1104I CTCTTC 3 cut(s) 129, 138, 272
EarI CTCTTC 3 cut(s) 129, 138, 272
Eco130I CCWWGG 3 cut(s) 85, 162, 357
Eco47I GGWCC 1 cut(s) 185
EcoT14I CCWWGG 3 cut(s) 85, 162, 357
EcoT22I ATGCAT 1 cut(s) 389
ErhI CCWWGG 3 cut(s) 85, 162, 357
FaeI CATG 3 cut(s) 89, 166, 387
FaiI YATR 9 cut(s) 8, 87, 111, 164, 208, 210, 378, 385, 399
FatI CATG 3 cut(s) 85, 162, 383
FspBI CTAG 2 cut(s) 59, 330
Hin1II CATG 3 cut(s) 89, 166, 387
HinfI GANTC 2 cut(s) 38, 91
HphI GGTGA 1 cut(s) 113
Hpy166II GTNNAC 1 cut(s) 48
Hpy188I TCNGA 1 cut(s) 172
Hpy188III TCNNGA 3 cut(s) 78, 183, 317
Hpy8I GTNNAC 1 cut(s) 48
HpyCH4V TGCA 1 cut(s) 387
HpyF10VI GCNNNNNNNGC 1 cut(s) 264
HpyF3I CTNAG 1 cut(s) 337
Hsp92II CATG 3 cut(s) 89, 166, 387
Kzo9I GATC 2 cut(s) 61, 154
LguI GCTCTTC 1 cut(s) 272
LmnI GCTCC 1 cut(s) 338
LpnPI CCDG 4 cut(s) 27, 63, 138, 168
LweI GCATC 1 cut(s) 163
MaeI CTAG 2 cut(s) 59, 330
MalI GATC 2 cut(s) 63, 156
MboI GATC 2 cut(s) 61, 154
MboII GAAGA 8 cut(s) 146, 152, 155, 171, 224, 231, 289, 334
MflI RGATCY 1 cut(s) 154
MluCI AATT 4 cut(s) 128, 203, 235, 251
MnlI CCTC 7 cut(s) 130, 139, 142, 145, 198, 287, 346
Mph1103I ATGCAT 1 cut(s) 389
MseI TTAA 1 cut(s) 234
MslI CAYNNNNRTG 1 cut(s) 318
MwoI GCNNNNNNNGC 1 cut(s) 264
NcoI CCATGG 2 cut(s) 85, 162
NdeII GATC 2 cut(s) 61, 154
NheI GCTAGC 1 cut(s) 329
NlaIII CATG 3 cut(s) 89, 166, 387
NsiI ATGCAT 1 cut(s) 389
NspI RCATGY 1 cut(s) 387
PciSI GCTCTTC 1 cut(s) 272
PfeI GAWTC 2 cut(s) 38, 91
PsiI TTATAA 1 cut(s) 399
PspPI GGNCC 1 cut(s) 185
PsuI RGATCY 1 cut(s) 154
RseI CAYNNNNRTG 1 cut(s) 318
SapI GCTCTTC 1 cut(s) 272
SaqAI TTAA 1 cut(s) 234
Sau3AI GATC 2 cut(s) 61, 154
Sau96I GGNCC 1 cut(s) 185
SetI ASST 4 cut(s) 60, 103, 190, 335
SfaNI GCATC 1 cut(s) 163
SinI GGWCC 1 cut(s) 185
SmiMI CAYNNNNRTG 1 cut(s) 318
Sse9I AATT 4 cut(s) 128, 203, 235, 251
SspMI CTAG 2 cut(s) 59, 330
StyI CCWWGG 3 cut(s) 85, 162, 357
TasI AATT 4 cut(s) 128, 203, 235, 251
TfiI GAWTC 2 cut(s) 38, 91
Tru1I TTAA 1 cut(s) 234
Tru9I TTAA 1 cut(s) 234
TscAI CASTG 1 cut(s) 331
TspDTI ATGAA 2 cut(s) 17, 225
TspRI CASTG 1 cut(s) 331
VpaK11BI GGWCC 1 cut(s) 185
XapI RAATTY 1 cut(s) 128
XceI RCATGY 1 cut(s) 387
XspI CTAG 2 cut(s) 59, 330
Zsp2I ATGCAT 1 cut(s) 389
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.