Rh6BG498000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0003210
Physical Location & Seq
Forward (+)
69860550 .. 69862809
2260 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG498000.1

Sequence Viewer

Length: 396 bp
ATGAACATATCACAATCACAATACAATAGTGGGTGTGAATCTGGGTGGACACATTACCTAGATCAGTCGTATCTTTCTGGAAGCCATGGGATTCAAAAAGGTGATGATTATGTAGGAACAAAACCAGAATTTGAAGAGGAAGAAGAGGAGGAGGATCTATCCATGGTGTCTGATGCTTCTTCTGGACCTCCACATTACCAAGAATTATATGAAGATGGGTGTTCGTTTTCGGTTAATTCTTCGGCTTCCAAATTAGGCAAGAAAAGCAAGAAAAAGAAGAGCAAAGAACAACACCACCATCTTGATGACACTGCTAGCTCCTCAGTCTTCAACTACTACTCCAAGGCAAAATCAAAGTCTCATACAACATGCATTGATAGTTATAAAGATTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

131

Amino Acids

14.74

Weight (kDa)

5.27

Isoelectric Point (pI)

54.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 384
AclWI GGATC 1 cut(s) 162
AcsI RAATTY 1 cut(s) 128
AgsI TTSAA 3 cut(s) 95, 134, 331
AluBI AGCT 1 cut(s) 318
AluI AGCT 1 cut(s) 318
Alw26I GTCTC 1 cut(s) 363
AlwI GGATC 1 cut(s) 162
ApoI RAATTY 1 cut(s) 128
ArsI GACNNNNNNTTYG 2 cut(s) 341, 373
AspS9I GGNCC 1 cut(s) 185
AsuHPI GGTGA 1 cut(s) 113
AsuNHI GCTAGC 1 cut(s) 314
AvaII GGWCC 1 cut(s) 185
BbsI GAAGAC 1 cut(s) 319
BccI CCATC 2 cut(s) 209, 306
BcoDI GTCTC 1 cut(s) 363
BfaI CTAG 2 cut(s) 59, 315
Bme18I GGWCC 1 cut(s) 185
BmgT120I GGNCC 1 cut(s) 185
BmsI GCATC 1 cut(s) 163
BmtI GCTAGC 1 cut(s) 318
BpiI GAAGAC 1 cut(s) 319
BsaJI CCNNGG 3 cut(s) 85, 162, 342
BsaXI ACNNNNNCTCC 2 cut(s) 323, 353
BseDI CCNNGG 3 cut(s) 85, 162, 342
BseMII CTCAG 1 cut(s) 336
BseRI GAGGAG 3 cut(s) 161, 164, 310
BsmAI GTCTC 1 cut(s) 363
Bsp143I GATC 2 cut(s) 61, 154
Bsp19I CCATGG 2 cut(s) 85, 162
BspCNI CTCAG 1 cut(s) 335
BspOI GCTAGC 1 cut(s) 318
BspPI GGATC 1 cut(s) 162
BspQI GCTCTTC 1 cut(s) 272
BssECI CCNNGG 3 cut(s) 85, 162, 342
BssMI GATC 2 cut(s) 61, 154
BssT1I CCWWGG 3 cut(s) 85, 162, 342
Bst6I CTCTTC 3 cut(s) 129, 138, 272
BstC8I GCNNGC 1 cut(s) 316
BstDEI CTNAG 1 cut(s) 322
BstDSI CCRYGG 2 cut(s) 85, 162
BstKTI GATC 2 cut(s) 64, 157
BstMAI GTCTC 1 cut(s) 363
BstMBI GATC 2 cut(s) 61, 154
BstMWI GCNNNNNNNGC 1 cut(s) 264
BstNSI RCATGY 1 cut(s) 372
BstV2I GAAGAC 1 cut(s) 319
BstX2I RGATCY 1 cut(s) 154
BstYI RGATCY 1 cut(s) 154
BtgI CCRYGG 2 cut(s) 85, 162
BtsI GCAGTG 1 cut(s) 309
BtsIMutI CAGTG 1 cut(s) 309
Cac8I GCNNGC 1 cut(s) 316
Cfr13I GGNCC 1 cut(s) 185
CviAII CATG 3 cut(s) 86, 163, 369
CviJI RGCY 3 cut(s) 84, 245, 318
CviKI_1 RGCY 3 cut(s) 84, 245, 318
DdeI CTNAG 1 cut(s) 322
DpnI GATC 2 cut(s) 63, 156
DpnII GATC 2 cut(s) 61, 154
Eam1104I CTCTTC 3 cut(s) 129, 138, 272
EarI CTCTTC 3 cut(s) 129, 138, 272
Eco130I CCWWGG 3 cut(s) 85, 162, 342
Eco47I GGWCC 1 cut(s) 185
EcoT14I CCWWGG 3 cut(s) 85, 162, 342
EcoT22I ATGCAT 1 cut(s) 374
ErhI CCWWGG 3 cut(s) 85, 162, 342
FaeI CATG 3 cut(s) 89, 166, 372
FaiI YATR 9 cut(s) 8, 87, 111, 164, 208, 210, 363, 370, 384
FatI CATG 3 cut(s) 85, 162, 368
FspBI CTAG 2 cut(s) 59, 315
Hin1II CATG 3 cut(s) 89, 166, 372
HinfI GANTC 2 cut(s) 38, 91
HphI GGTGA 1 cut(s) 113
Hpy166II GTNNAC 1 cut(s) 48
Hpy188I TCNGA 1 cut(s) 172
Hpy188III TCNNGA 3 cut(s) 78, 183, 302
Hpy8I GTNNAC 1 cut(s) 48
HpyCH4V TGCA 1 cut(s) 372
HpyF10VI GCNNNNNNNGC 1 cut(s) 264
HpyF3I CTNAG 1 cut(s) 322
Hsp92II CATG 3 cut(s) 89, 166, 372
Kzo9I GATC 2 cut(s) 61, 154
LguI GCTCTTC 1 cut(s) 272
LmnI GCTCC 1 cut(s) 323
LpnPI CCDG 4 cut(s) 27, 63, 138, 168
LweI GCATC 1 cut(s) 163
MaeI CTAG 2 cut(s) 59, 315
MalI GATC 2 cut(s) 63, 156
MboI GATC 2 cut(s) 61, 154
MboII GAAGA 8 cut(s) 146, 152, 155, 171, 224, 231, 289, 319
MflI RGATCY 1 cut(s) 154
MluCI AATT 4 cut(s) 128, 203, 235, 251
MnlI CCTC 6 cut(s) 130, 139, 142, 145, 198, 331
Mph1103I ATGCAT 1 cut(s) 374
MseI TTAA 1 cut(s) 234
MslI CAYNNNNRTG 1 cut(s) 303
MwoI GCNNNNNNNGC 1 cut(s) 264
NcoI CCATGG 2 cut(s) 85, 162
NdeII GATC 2 cut(s) 61, 154
NheI GCTAGC 1 cut(s) 314
NlaIII CATG 3 cut(s) 89, 166, 372
NsiI ATGCAT 1 cut(s) 374
NspI RCATGY 1 cut(s) 372
PciSI GCTCTTC 1 cut(s) 272
PfeI GAWTC 2 cut(s) 38, 91
PsiI TTATAA 1 cut(s) 384
PspPI GGNCC 1 cut(s) 185
PsuI RGATCY 1 cut(s) 154
RseI CAYNNNNRTG 1 cut(s) 303
SapI GCTCTTC 1 cut(s) 272
SaqAI TTAA 1 cut(s) 234
Sau3AI GATC 2 cut(s) 61, 154
Sau96I GGNCC 1 cut(s) 185
SetI ASST 4 cut(s) 60, 103, 190, 320
SfaNI GCATC 1 cut(s) 163
SinI GGWCC 1 cut(s) 185
SmiMI CAYNNNNRTG 1 cut(s) 303
Sse9I AATT 4 cut(s) 128, 203, 235, 251
SspMI CTAG 2 cut(s) 59, 315
StyI CCWWGG 3 cut(s) 85, 162, 342
TasI AATT 4 cut(s) 128, 203, 235, 251
TfiI GAWTC 2 cut(s) 38, 91
Tru1I TTAA 1 cut(s) 234
Tru9I TTAA 1 cut(s) 234
TscAI CASTG 1 cut(s) 316
TspDTI ATGAA 2 cut(s) 17, 225
TspRI CASTG 1 cut(s) 316
VpaK11BI GGWCC 1 cut(s) 185
XapI RAATTY 1 cut(s) 128
XceI RCATGY 1 cut(s) 372
XspI CTAG 2 cut(s) 59, 315
Zsp2I ATGCAT 1 cut(s) 374
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.