Rmu_ssc0000373.1_g000004

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000373.1
Physical Location & Seq
Reverse (-)
35164 .. 36016
853 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000373.1_g000004.1.cds

Sequence Viewer

Length: 561 bp
atgaacatatcacaatcacaatacaatagtgggtgtgaatctgggtggacacattacctagatcagtcgtatctttctggaagccatgggattcaaaaaggtgatgattatgtaggaacaaaaccagaatttgaagaggaagaagaggaggaggatctatccatggtgtctgatgcttcttctggacctccacattaccaagaattatatgaagatgggtgttcgttttcggttaattcttcggcttccaaattaggcaagaaaagcaagaaaaagaagagcaaagaaagtagaggcaaagaacaacaccaccatcttgatgacactgctagctcctcagtcttcaactactactccaagaaaaagatgagtactctttccaagaatgaaccttcaatgcagaatgtactggattactctgagggtttctcaacaacacatatgaagggaaaatctgctttgctgcagcactttggttacttgaactcatctctagctccacaaaacctggtgattttcaaggaggaagctgggagtaatgattatgatgggaatgaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

186

Amino Acids

20.76

Weight (kDa)

5.26

Isoelectric Point (pI)

53.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 162
AcsI RAATTY 1 cut(s) 128
AfaI GTAC 2 cut(s) 373, 408
AgsI TTSAA 6 cut(s) 95, 134, 346, 396, 484, 520
AjnI CCWGG 1 cut(s) 507
AluBI AGCT 3 cut(s) 333, 497, 530
AluI AGCT 3 cut(s) 333, 497, 530
AlwI GGATC 1 cut(s) 162
ApeKI GCWGC 2 cut(s) 463, 466
ApoI RAATTY 1 cut(s) 128
AspS9I GGNCC 1 cut(s) 185
AsuHPI GGTGA 2 cut(s) 113, 523
AsuNHI GCTAGC 1 cut(s) 329
AvaII GGWCC 1 cut(s) 185
BbsI GAAGAC 1 cut(s) 334
BbvI GCAGC 2 cut(s) 450, 478
BccI CCATC 3 cut(s) 209, 321, 542
BciT130I CCWGG 1 cut(s) 509
BfaI CTAG 3 cut(s) 59, 330, 494
BfmI CTRYAG 1 cut(s) 464
BisI GCNGC 2 cut(s) 464, 467
BlsI GCNGC 2 cut(s) 465, 468
BmcAI AGTACT 1 cut(s) 373
Bme1390I CCNGG 1 cut(s) 509
Bme18I GGWCC 1 cut(s) 185
BmgT120I GGNCC 1 cut(s) 185
BmrFI CCNGG 1 cut(s) 509
BmsI GCATC 1 cut(s) 163
BmtI GCTAGC 1 cut(s) 333
BpiI GAAGAC 1 cut(s) 334
BplI GAGNNNNNCTC 2 cut(s) 413, 445
BsaJI CCNNGG 2 cut(s) 85, 162
BsaXI ACNNNNNCTCC 2 cut(s) 338, 368
Bse1I ACTGG 1 cut(s) 414
BseBI CCWGG 1 cut(s) 509
BseDI CCNNGG 2 cut(s) 85, 162
BseMII CTCAG 2 cut(s) 351, 411
BseNI ACTGG 1 cut(s) 414
BseRI GAGGAG 3 cut(s) 161, 164, 325
BseXI GCAGC 2 cut(s) 450, 478
BseYI CCCAGC 1 cut(s) 530
Bsp143I GATC 2 cut(s) 61, 154
Bsp19I CCATGG 2 cut(s) 85, 162
BspCNI CTCAG 2 cut(s) 350, 412
BspMAI CTGCAG 1 cut(s) 468
BspOI GCTAGC 1 cut(s) 333
BspPI GGATC 1 cut(s) 162
BspQI GCTCTTC 1 cut(s) 272
BsrI ACTGG 1 cut(s) 414
BssECI CCNNGG 2 cut(s) 85, 162
BssMI GATC 2 cut(s) 61, 154
BssT1I CCWWGG 2 cut(s) 85, 162
Bst2UI CCWGG 1 cut(s) 509
Bst6I CTCTTC 3 cut(s) 129, 138, 272
BstC8I GCNNGC 1 cut(s) 331
BstDEI CTNAG 2 cut(s) 337, 420
BstDSI CCRYGG 2 cut(s) 85, 162
BstKTI GATC 2 cut(s) 64, 157
BstMBI GATC 2 cut(s) 61, 154
BstMWI GCNNNNNNNGC 1 cut(s) 264
BstNI CCWGG 1 cut(s) 509
BstSCI CCNGG 1 cut(s) 507
BstSFI CTRYAG 1 cut(s) 464
BstV1I GCAGC 2 cut(s) 450, 478
BstV2I GAAGAC 1 cut(s) 334
BstX2I RGATCY 1 cut(s) 154
BstYI RGATCY 1 cut(s) 154
BtgI CCRYGG 2 cut(s) 85, 162
BtsI GCAGTG 1 cut(s) 324
BtsIMutI CAGTG 1 cut(s) 324
Cac8I GCNNGC 1 cut(s) 331
Cfr13I GGNCC 1 cut(s) 185
CsiI ACCWGGT 1 cut(s) 507
Csp6I GTAC 2 cut(s) 372, 407
CviAII CATG 2 cut(s) 86, 163
CviJI RGCY 5 cut(s) 84, 245, 333, 497, 530
CviKI_1 RGCY 5 cut(s) 84, 245, 333, 497, 530
CviQI GTAC 2 cut(s) 372, 407
DdeI CTNAG 2 cut(s) 337, 420
DpnI GATC 2 cut(s) 63, 156
DpnII GATC 2 cut(s) 61, 154
Eam1104I CTCTTC 3 cut(s) 129, 138, 272
EarI CTCTTC 3 cut(s) 129, 138, 272
Eco130I CCWWGG 2 cut(s) 85, 162
Eco47I GGWCC 1 cut(s) 185
EcoRII CCWGG 1 cut(s) 507
EcoT14I CCWWGG 2 cut(s) 85, 162
ErhI CCWWGG 2 cut(s) 85, 162
FaeI CATG 2 cut(s) 89, 166
FaiI YATR 9 cut(s) 8, 87, 111, 164, 208, 210, 441, 443, 546
FatI CATG 2 cut(s) 85, 162
FauNDI CATATG 1 cut(s) 441
Fnu4HI GCNGC 2 cut(s) 464, 467
Fsp4HI GCNGC 2 cut(s) 464, 467
FspBI CTAG 3 cut(s) 59, 330, 494
GluI GCNGC 2 cut(s) 464, 467
GsaI CCCAGC 1 cut(s) 534
Hin1II CATG 2 cut(s) 89, 166
HinfI GANTC 2 cut(s) 38, 91
HphI GGTGA 2 cut(s) 113, 523
Hpy166II GTNNAC 1 cut(s) 48
Hpy188I TCNGA 2 cut(s) 172, 421
Hpy188III TCNNGA 3 cut(s) 78, 183, 317
Hpy8I GTNNAC 1 cut(s) 48
HpyAV CCTTC 2 cut(s) 402, 439
HpyCH4V TGCA 2 cut(s) 400, 466
HpyF10VI GCNNNNNNNGC 1 cut(s) 264
HpyF3I CTNAG 2 cut(s) 337, 420
Hsp92II CATG 2 cut(s) 89, 166
Kzo9I GATC 2 cut(s) 61, 154
LguI GCTCTTC 1 cut(s) 272
LmnI GCTCC 2 cut(s) 338, 502
LpnPI CCDG 8 cut(s) 27, 63, 138, 168, 395, 494, 516, 521
Lsp1109I GCAGC 2 cut(s) 450, 478
LweI GCATC 1 cut(s) 163
MabI ACCWGGT 1 cut(s) 507
MaeI CTAG 3 cut(s) 59, 330, 494
MaeIII GTNAC 1 cut(s) 476
MalI GATC 2 cut(s) 63, 156
MboI GATC 2 cut(s) 61, 154
MboII GAAGA 8 cut(s) 146, 152, 155, 171, 224, 231, 289, 334
MflI RGATCY 1 cut(s) 154
MluCI AATT 4 cut(s) 128, 203, 235, 251
MnlI CCTC 9 cut(s) 130, 139, 142, 145, 198, 287, 346, 415, 517
MseI TTAA 1 cut(s) 234
MslI CAYNNNNRTG 1 cut(s) 318
MspR9I CCNGG 1 cut(s) 509
MvaI CCWGG 1 cut(s) 509
MwoI GCNNNNNNNGC 1 cut(s) 264
NcoI CCATGG 2 cut(s) 85, 162
NdeI CATATG 1 cut(s) 441
NdeII GATC 2 cut(s) 61, 154
NheI GCTAGC 1 cut(s) 329
NlaIII CATG 2 cut(s) 89, 166
PciSI GCTCTTC 1 cut(s) 272
PfeI GAWTC 2 cut(s) 38, 91
PkrI GCNGC 2 cut(s) 465, 468
Psp6I CCWGG 1 cut(s) 507
PspFI CCCAGC 1 cut(s) 530
PspGI CCWGG 1 cut(s) 507
PspPI GGNCC 1 cut(s) 185
PstI CTGCAG 1 cut(s) 468
PsuI RGATCY 1 cut(s) 154
RsaI GTAC 2 cut(s) 373, 408
RsaNI GTAC 2 cut(s) 372, 407
RseI CAYNNNNRTG 1 cut(s) 318
SapI GCTCTTC 1 cut(s) 272
SaqAI TTAA 1 cut(s) 234
SatI GCNGC 2 cut(s) 464, 467
Sau3AI GATC 2 cut(s) 61, 154
Sau96I GGNCC 1 cut(s) 185
ScaI AGTACT 1 cut(s) 373
ScrFI CCNGG 1 cut(s) 509
SetI ASST 8 cut(s) 60, 103, 190, 335, 394, 499, 510, 532
SexAI ACCWGGT 1 cut(s) 507
SfaNI GCATC 1 cut(s) 163
SfcI CTRYAG 1 cut(s) 464
SinI GGWCC 1 cut(s) 185
SmiMI CAYNNNNRTG 1 cut(s) 318
Sse9I AATT 4 cut(s) 128, 203, 235, 251
SspMI CTAG 3 cut(s) 59, 330, 494
StyD4I CCNGG 1 cut(s) 507
StyI CCWWGG 2 cut(s) 85, 162
TasI AATT 4 cut(s) 128, 203, 235, 251
TatI WGTACW 2 cut(s) 371, 406
TfiI GAWTC 2 cut(s) 38, 91
Tru1I TTAA 1 cut(s) 234
Tru9I TTAA 1 cut(s) 234
TscAI CASTG 1 cut(s) 331
TseI GCWGC 2 cut(s) 463, 466
TspDTI ATGAA 4 cut(s) 17, 225, 402, 458
TspRI CASTG 1 cut(s) 331
VpaK11BI GGWCC 1 cut(s) 185
XapI RAATTY 1 cut(s) 128
XspI CTAG 3 cut(s) 59, 330, 494
ZrmI AGTACT 1 cut(s) 373
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.