Rh6AG488400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
66591906 .. 66592749
844 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG488400.1

Sequence Viewer

Length: 552 bp
ATGAACATATCACAATCACAATACAATAGTGGGTGTGAATCTGGGTGGACACATTACCTAGATCAGTCGTATCTTTCTGGAAGCCATGGGATTCAAAAAGGTGATGATTATGTAGGAACAAAACCAGAATTTGAAGAGGAAGAAGAGGAGGAGGATCTATCCATGGTGTCTGATGCTTCTTCTGGACCTCCACATTACCAAGAATTATATGAAGATGGGTGTTCGTTTTCTGTTAATTCTTCGGCTTCCAAATTAGGCAAGAAAAAGAAGAGCAAAGAAAGTAGAGGCAAAGAACAACACCACCATCTTGATGACACCGCTAGCTCCTCAGTCTTCAACTACTACTCCAAGAAAAAGATGAGTACTCTTTCCAAGAATGAACCTTCAATGCAGAATGTACTGGAATACTCTGAGGGTTTCTCAACAACACATATGAAGGGAAAATCTGCTTTGCTGCAGCACTTTGGTTACTTGAACTCATCTCTAGCTCCACAAAACCTGGTGATTTTCAAGGAGGAGGCTGGGAGTAATGATTATGATGGGAATGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

183

Amino Acids

20.43

Weight (kDa)

5.07

Isoelectric Point (pI)

54.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 318
AclWI GGATC 1 cut(s) 162
AcsI RAATTY 1 cut(s) 128
AfaI GTAC 2 cut(s) 364, 399
AgsI TTSAA 6 cut(s) 95, 134, 337, 387, 475, 511
AjnI CCWGG 1 cut(s) 498
AluBI AGCT 2 cut(s) 324, 488
AluI AGCT 2 cut(s) 324, 488
AlwI GGATC 1 cut(s) 162
ApeKI GCWGC 2 cut(s) 454, 457
ApoI RAATTY 1 cut(s) 128
AspS9I GGNCC 1 cut(s) 185
AsuHPI GGTGA 2 cut(s) 113, 514
AsuNHI GCTAGC 1 cut(s) 320
AvaII GGWCC 1 cut(s) 185
BbsI GAAGAC 1 cut(s) 325
BbvI GCAGC 2 cut(s) 441, 469
BccI CCATC 3 cut(s) 209, 312, 533
BciT130I CCWGG 1 cut(s) 500
BfaI CTAG 3 cut(s) 59, 321, 485
BfmI CTRYAG 1 cut(s) 455
BisI GCNGC 2 cut(s) 455, 458
BlsI GCNGC 2 cut(s) 456, 459
BmcAI AGTACT 1 cut(s) 364
Bme1390I CCNGG 1 cut(s) 500
Bme18I GGWCC 1 cut(s) 185
BmgT120I GGNCC 1 cut(s) 185
BmrFI CCNGG 1 cut(s) 500
BmsI GCATC 1 cut(s) 163
BmtI GCTAGC 1 cut(s) 324
BpiI GAAGAC 1 cut(s) 325
BplI GAGNNNNNCTC 2 cut(s) 404, 436
BsaJI CCNNGG 2 cut(s) 85, 162
BsaXI ACNNNNNCTCC 2 cut(s) 329, 359
Bse1I ACTGG 1 cut(s) 405
BseBI CCWGG 1 cut(s) 500
BseDI CCNNGG 2 cut(s) 85, 162
BseMII CTCAG 2 cut(s) 342, 402
BseNI ACTGG 1 cut(s) 405
BseRI GAGGAG 4 cut(s) 161, 164, 316, 530
BseXI GCAGC 2 cut(s) 441, 469
BseYI CCCAGC 1 cut(s) 521
Bsp143I GATC 2 cut(s) 61, 154
Bsp19I CCATGG 2 cut(s) 85, 162
BspACI CCGC 1 cut(s) 318
BspCNI CTCAG 2 cut(s) 341, 403
BspMAI CTGCAG 1 cut(s) 459
BspOI GCTAGC 1 cut(s) 324
BspPI GGATC 1 cut(s) 162
BspQI GCTCTTC 1 cut(s) 263
BsrI ACTGG 1 cut(s) 405
BssECI CCNNGG 2 cut(s) 85, 162
BssMI GATC 2 cut(s) 61, 154
BssT1I CCWWGG 2 cut(s) 85, 162
Bst2UI CCWGG 1 cut(s) 500
Bst6I CTCTTC 3 cut(s) 129, 138, 263
BstC8I GCNNGC 1 cut(s) 322
BstDEI CTNAG 2 cut(s) 328, 411
BstDSI CCRYGG 2 cut(s) 85, 162
BstKTI GATC 2 cut(s) 64, 157
BstMBI GATC 2 cut(s) 61, 154
BstNI CCWGG 1 cut(s) 500
BstSCI CCNGG 1 cut(s) 498
BstSFI CTRYAG 1 cut(s) 455
BstV1I GCAGC 2 cut(s) 441, 469
BstV2I GAAGAC 1 cut(s) 325
BstX2I RGATCY 1 cut(s) 154
BstYI RGATCY 1 cut(s) 154
BtgI CCRYGG 2 cut(s) 85, 162
Cac8I GCNNGC 1 cut(s) 322
Cfr13I GGNCC 1 cut(s) 185
CsiI ACCWGGT 1 cut(s) 498
Csp6I GTAC 2 cut(s) 363, 398
CviAII CATG 2 cut(s) 86, 163
CviJI RGCY 5 cut(s) 84, 245, 324, 488, 521
CviKI_1 RGCY 5 cut(s) 84, 245, 324, 488, 521
CviQI GTAC 2 cut(s) 363, 398
DdeI CTNAG 2 cut(s) 328, 411
DpnI GATC 2 cut(s) 63, 156
DpnII GATC 2 cut(s) 61, 154
Eam1104I CTCTTC 3 cut(s) 129, 138, 263
EarI CTCTTC 3 cut(s) 129, 138, 263
Eco130I CCWWGG 2 cut(s) 85, 162
Eco47I GGWCC 1 cut(s) 185
EcoRII CCWGG 1 cut(s) 498
EcoT14I CCWWGG 2 cut(s) 85, 162
ErhI CCWWGG 2 cut(s) 85, 162
FaeI CATG 2 cut(s) 89, 166
FaiI YATR 9 cut(s) 8, 87, 111, 164, 208, 210, 432, 434, 537
FatI CATG 2 cut(s) 85, 162
FauNDI CATATG 1 cut(s) 432
Fnu4HI GCNGC 2 cut(s) 455, 458
Fsp4HI GCNGC 2 cut(s) 455, 458
FspBI CTAG 3 cut(s) 59, 321, 485
GluI GCNGC 2 cut(s) 455, 458
GsaI CCCAGC 1 cut(s) 525
Hin1II CATG 2 cut(s) 89, 166
HinfI GANTC 2 cut(s) 38, 91
HphI GGTGA 2 cut(s) 113, 514
Hpy166II GTNNAC 1 cut(s) 48
Hpy188I TCNGA 2 cut(s) 172, 412
Hpy188III TCNNGA 3 cut(s) 78, 183, 308
Hpy8I GTNNAC 1 cut(s) 48
HpyAV CCTTC 2 cut(s) 393, 430
HpyCH4V TGCA 2 cut(s) 391, 457
HpyF3I CTNAG 2 cut(s) 328, 411
Hsp92II CATG 2 cut(s) 89, 166
Kzo9I GATC 2 cut(s) 61, 154
LguI GCTCTTC 1 cut(s) 263
LmnI GCTCC 2 cut(s) 329, 493
LpnPI CCDG 8 cut(s) 27, 63, 138, 168, 386, 485, 507, 512
Lsp1109I GCAGC 2 cut(s) 441, 469
LweI GCATC 1 cut(s) 163
MabI ACCWGGT 1 cut(s) 498
MaeI CTAG 3 cut(s) 59, 321, 485
MaeIII GTNAC 1 cut(s) 467
MalI GATC 2 cut(s) 63, 156
MboI GATC 2 cut(s) 61, 154
MboII GAAGA 8 cut(s) 146, 152, 155, 171, 224, 231, 280, 325
MflI RGATCY 1 cut(s) 154
MluCI AATT 4 cut(s) 128, 203, 235, 251
MseI TTAA 1 cut(s) 234
MslI CAYNNNNRTG 1 cut(s) 309
MspR9I CCNGG 1 cut(s) 500
MvaI CCWGG 1 cut(s) 500
NcoI CCATGG 2 cut(s) 85, 162
NdeI CATATG 1 cut(s) 432
NdeII GATC 2 cut(s) 61, 154
NheI GCTAGC 1 cut(s) 320
NlaIII CATG 2 cut(s) 89, 166
PciSI GCTCTTC 1 cut(s) 263
PfeI GAWTC 2 cut(s) 38, 91
PkrI GCNGC 2 cut(s) 456, 459
Psp6I CCWGG 1 cut(s) 498
PspFI CCCAGC 1 cut(s) 521
PspGI CCWGG 1 cut(s) 498
PspPI GGNCC 1 cut(s) 185
PstI CTGCAG 1 cut(s) 459
PsuI RGATCY 1 cut(s) 154
RsaI GTAC 2 cut(s) 364, 399
RsaNI GTAC 2 cut(s) 363, 398
RseI CAYNNNNRTG 1 cut(s) 309
SapI GCTCTTC 1 cut(s) 263
SaqAI TTAA 1 cut(s) 234
SatI GCNGC 2 cut(s) 455, 458
Sau3AI GATC 2 cut(s) 61, 154
Sau96I GGNCC 1 cut(s) 185
ScaI AGTACT 1 cut(s) 364
ScrFI CCNGG 1 cut(s) 500
SetI ASST 7 cut(s) 60, 103, 190, 326, 385, 490, 501
SexAI ACCWGGT 1 cut(s) 498
SfaNI GCATC 1 cut(s) 163
SfcI CTRYAG 1 cut(s) 455
SinI GGWCC 1 cut(s) 185
SmiMI CAYNNNNRTG 1 cut(s) 309
Sse9I AATT 4 cut(s) 128, 203, 235, 251
SsiI CCGC 1 cut(s) 318
SspMI CTAG 3 cut(s) 59, 321, 485
StyD4I CCNGG 1 cut(s) 498
StyI CCWWGG 2 cut(s) 85, 162
TasI AATT 4 cut(s) 128, 203, 235, 251
TatI WGTACW 2 cut(s) 362, 397
TfiI GAWTC 2 cut(s) 38, 91
Tru1I TTAA 1 cut(s) 234
Tru9I TTAA 1 cut(s) 234
TseI GCWGC 2 cut(s) 454, 457
TspDTI ATGAA 4 cut(s) 17, 225, 393, 449
VpaK11BI GGWCC 1 cut(s) 185
XapI RAATTY 1 cut(s) 128
XspI CTAG 3 cut(s) 59, 321, 485
ZrmI AGTACT 1 cut(s) 364
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.