Rmu_sc0002354.1_g000011

RING-H2 finger protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002354.1
Physical Location & Seq
Forward (+)
58228 .. 58731
504 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002354.1_g000011.1.cds

Sequence Viewer

Length: 504 bp
atgtcaatatcattgcttttttctggcattatgatcttaggggtgatactcatttgctttgtaatttacattgtatttacagtagcatggtacttatatggtaggcaaatactatctgctccaacattaagccagcaggaggacccagccaaggagaagtactttagttaccagaaactgaagccggatgtgatcacattcaactacaagaaagaattgagtgatgatccaaatcacgaagaagagaattctgatcaaaatgaatgcgtggtgtgcttaagaggtttacagaatgaggaatttgtgaggcaactgccaaaatgcaagcacacattccacgcgccttgtatagacatgtggctctactctcactctgattgccccatctgtcggacggtgattgatcagttgcctgatgtaggtgcatttacaccaggccggaagtcggaggtctctgtagatatcagcccatcattgaccttaacaaccatctcaataatctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

167

Amino Acids

19.04

Weight (kDa)

5.13

Isoelectric Point (pI)

42.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 341
AclWI GGATC 1 cut(s) 221
AcsI RAATTY 2 cut(s) 247, 299
AcuI CTGAAG 1 cut(s) 200
AfaI GTAC 2 cut(s) 92, 161
AfiI CCNNNNNNNGG 5 cut(s) 139, 151, 390, 419, 445
AflII CTTAAG 1 cut(s) 277
AflIII ACRYGT 1 cut(s) 354
AgsI TTSAA 1 cut(s) 202
AjnI CCWGG 1 cut(s) 433
Alw26I GTCTC 1 cut(s) 457
AlwI GGATC 1 cut(s) 221
AlwNI CAGNNNCTG 1 cut(s) 178
AoxI GGCC 1 cut(s) 436
ApoI RAATTY 2 cut(s) 247, 299
AspLEI GCGC 1 cut(s) 343
AspS9I GGNCC 1 cut(s) 142
AsuHPI GGTGA 2 cut(s) 55, 409
AvaII GGWCC 1 cut(s) 142
BccI CCATC 3 cut(s) 392, 478, 497
BciT130I CCWGG 1 cut(s) 435
BclI TGATCA 3 cut(s) 192, 253, 403
BcoDI GTCTC 1 cut(s) 457
BfaI CTAG 1 cut(s) 502
BfmI CTRYAG 1 cut(s) 456
BfrI CTTAAG 1 cut(s) 277
BmcAI AGTACT 1 cut(s) 161
Bme1390I CCNGG 1 cut(s) 435
Bme18I GGWCC 1 cut(s) 142
BmgT120I GGNCC 1 cut(s) 142
BmiI GGNNCC 1 cut(s) 144
BmrFI CCNGG 1 cut(s) 435
BsaBI GATNNNNATC 1 cut(s) 231
BsaI GGTCTC 1 cut(s) 457
BsaJI CCNNGG 1 cut(s) 150
Bsc4I CCNNNNNNNGG 5 cut(s) 139, 151, 390, 419, 445
Bse3DI GCAATG 1 cut(s) 11
Bse8I GATNNNNATC 1 cut(s) 231
BseBI CCWGG 1 cut(s) 435
BseDI CCNNGG 1 cut(s) 150
BseGI GGATG 1 cut(s) 193
BseJI GATNNNNATC 1 cut(s) 231
BseLI CCNNNNNNNGG 5 cut(s) 139, 151, 390, 419, 445
BseMI GCAATG 1 cut(s) 11
BseYI CCCAGC 1 cut(s) 145
Bsh1236I CGCG 1 cut(s) 341
BshFI GGCC 1 cut(s) 438
BsiSI CCGG 2 cut(s) 185, 439
BslI CCNNNNNNNGG 5 cut(s) 139, 151, 390, 419, 445
BsmAI GTCTC 1 cut(s) 457
BsmI GAATGC 1 cut(s) 269
BsnI GGCC 1 cut(s) 438
Bso31I GGTCTC 1 cut(s) 457
Bsp143I GATC 5 cut(s) 33, 192, 226, 253, 403
BspANI GGCC 1 cut(s) 438
BspFNI CGCG 1 cut(s) 341
BspLI GGNNCC 1 cut(s) 144
BspPI GGATC 1 cut(s) 221
BspTI CTTAAG 1 cut(s) 277
BspTNI GGTCTC 1 cut(s) 457
BsrDI GCAATG 1 cut(s) 11
BssECI CCNNGG 1 cut(s) 150
BssMI GATC 5 cut(s) 33, 192, 226, 253, 403
BssT1I CCWWGG 1 cut(s) 150
Bst2UI CCWGG 1 cut(s) 435
Bst4CI ACNGT 2 cut(s) 82, 397
Bst6I CTCTTC 1 cut(s) 237
BstAFI CTTAAG 1 cut(s) 277
BstC8I GCNNGC 2 cut(s) 134, 326
BstDEI CTNAG 1 cut(s) 37
BstENI CCTNNNNNAGG 1 cut(s) 417
BstF5I GGATG 1 cut(s) 193
BstFNI CGCG 1 cut(s) 341
BstHHI GCGC 1 cut(s) 343
BstKTI GATC 5 cut(s) 36, 195, 229, 256, 406
BstMAI GTCTC 1 cut(s) 457
BstMBI GATC 5 cut(s) 33, 192, 226, 253, 403
BstMWI GCNNNNNNNGC 1 cut(s) 273
BstNI CCWGG 1 cut(s) 435
BstNSI RCATGY 1 cut(s) 358
BstSCI CCNGG 1 cut(s) 433
BstSFI CTRYAG 1 cut(s) 456
BstUI CGCG 1 cut(s) 341
BsuRI GGCC 1 cut(s) 438
BtsCI GGATG 1 cut(s) 193
Cac8I GCNNGC 2 cut(s) 134, 326
CaiI CAGNNNCTG 1 cut(s) 178
CfoI GCGC 1 cut(s) 343
Cfr13I GGNCC 1 cut(s) 142
Csp6I GTAC 2 cut(s) 91, 160
CspCI CAANNNNNGTGG 2 cut(s) 326, 361
CviAII CATG 2 cut(s) 87, 355
CviJI RGCY 6 cut(s) 132, 149, 184, 361, 438, 468
CviKI_1 RGCY 6 cut(s) 132, 149, 184, 361, 438, 468
CviQI GTAC 2 cut(s) 91, 160
DdeI CTNAG 1 cut(s) 37
DpnI GATC 5 cut(s) 35, 194, 228, 255, 405
DpnII GATC 5 cut(s) 33, 192, 226, 253, 403
Eam1104I CTCTTC 1 cut(s) 237
EarI CTCTTC 1 cut(s) 237
Eco130I CCWWGG 1 cut(s) 150
Eco31I GGTCTC 1 cut(s) 457
Eco32I GATATC 1 cut(s) 463
Eco47I GGWCC 1 cut(s) 142
Eco57I CTGAAG 1 cut(s) 200
EcoNI CCTNNNNNAGG 1 cut(s) 417
EcoO109I RGGNCCY 1 cut(s) 142
EcoRI GAATTC 1 cut(s) 247
EcoRII CCWGG 1 cut(s) 433
EcoRV GATATC 1 cut(s) 463
EcoT14I CCWWGG 1 cut(s) 150
ErhI CCWWGG 1 cut(s) 150
FaeI CATG 2 cut(s) 90, 358
FaiI YATR 6 cut(s) 32, 88, 97, 99, 350, 356
FatI CATG 2 cut(s) 86, 354
FbaI TGATCA 3 cut(s) 192, 253, 403
FokI GGATG 1 cut(s) 200
FspBI CTAG 1 cut(s) 502
GlaI GCGC 1 cut(s) 342
GsaI CCCAGC 1 cut(s) 149
HaeIII GGCC 1 cut(s) 438
HapII CCGG 2 cut(s) 185, 439
HhaI GCGC 1 cut(s) 343
Hin1II CATG 2 cut(s) 90, 358
Hin6I GCGC 1 cut(s) 341
HinP1I GCGC 1 cut(s) 341
HpaII CCGG 2 cut(s) 185, 439
HphI GGTGA 2 cut(s) 55, 409
Hpy166II GTNNAC 1 cut(s) 287
Hpy188I TCNGA 4 cut(s) 253, 376, 393, 448
Hpy188III TCNNGA 1 cut(s) 236
Hpy8I GTNNAC 1 cut(s) 287
HpyCH4III ACNGT 2 cut(s) 82, 397
HpyCH4V TGCA 2 cut(s) 324, 425
HpyF10VI GCNNNNNNNGC 1 cut(s) 273
HpyF3I CTNAG 1 cut(s) 37
Hsp92II CATG 2 cut(s) 90, 358
HspAI GCGC 1 cut(s) 341
Ksp22I TGATCA 3 cut(s) 192, 253, 403
Kzo9I GATC 5 cut(s) 33, 192, 226, 253, 403
LmnI GCTCC 1 cut(s) 124
MaeI CTAG 1 cut(s) 502
MaeIII GTNAC 1 cut(s) 167
MalI GATC 5 cut(s) 35, 194, 228, 255, 405
MboI GATC 5 cut(s) 33, 192, 226, 253, 403
MboII GAAGA 2 cut(s) 251, 254
MluCI AATT 4 cut(s) 63, 215, 247, 299
MmeI TCCRAC 3 cut(s) 146, 371, 426
MnlI CCTC 5 cut(s) 133, 275, 289, 300, 442
MseI TTAA 3 cut(s) 128, 278, 482
MspCI CTTAAG 1 cut(s) 277
MspI CCGG 2 cut(s) 185, 439
MspR9I CCNGG 1 cut(s) 435
Mva1269I GAATGC 1 cut(s) 269
MvaI CCWGG 1 cut(s) 435
MvnI CGCG 1 cut(s) 341
MwoI GCNNNNNNNGC 1 cut(s) 273
NdeII GATC 5 cut(s) 33, 192, 226, 253, 403
NlaIII CATG 2 cut(s) 90, 358
NlaIV GGNNCC 1 cut(s) 144
NspI RCATGY 1 cut(s) 358
PciI ACATGT 1 cut(s) 354
PctI GAATGC 1 cut(s) 269
PpuMI RGGWCCY 1 cut(s) 142
PscI ACATGT 1 cut(s) 354
Psp5II RGGWCCY 1 cut(s) 142
Psp6I CCWGG 1 cut(s) 433
PspFI CCCAGC 1 cut(s) 145
PspGI CCWGG 1 cut(s) 433
PspN4I GGNNCC 1 cut(s) 144
PspPI GGNCC 1 cut(s) 142
PspPPI RGGWCCY 1 cut(s) 142
PstNI CAGNNNCTG 1 cut(s) 178
RsaI GTAC 2 cut(s) 92, 161
RsaNI GTAC 2 cut(s) 91, 160
SaqAI TTAA 3 cut(s) 128, 278, 482
Sau3AI GATC 5 cut(s) 33, 192, 226, 253, 403
Sau96I GGNCC 1 cut(s) 142
ScaI AGTACT 1 cut(s) 161
ScrFI CCNGG 1 cut(s) 435
SetI ASST 4 cut(s) 286, 424, 453, 482
SfcI CTRYAG 1 cut(s) 456
SinI GGWCC 1 cut(s) 142
SmlI CTYRAG 1 cut(s) 277
SmoI CTYRAG 1 cut(s) 277
Sse9I AATT 4 cut(s) 63, 215, 247, 299
SspMI CTAG 1 cut(s) 502
StyD4I CCNGG 1 cut(s) 433
StyI CCWWGG 1 cut(s) 150
TaaI ACNGT 2 cut(s) 82, 397
TasI AATT 4 cut(s) 63, 215, 247, 299
TatI WGTACW 1 cut(s) 159
Tru1I TTAA 3 cut(s) 128, 278, 482
Tru9I TTAA 3 cut(s) 128, 278, 482
TspDTI ATGAA 1 cut(s) 276
Vha464I CTTAAG 1 cut(s) 277
VpaK11BI GGWCC 1 cut(s) 142
XagI CCTNNNNNAGG 1 cut(s) 417
XapI RAATTY 2 cut(s) 247, 299
XceI RCATGY 1 cut(s) 358
XspI CTAG 1 cut(s) 502
ZrmI AGTACT 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.