Rmu_sc0002674.1_g000015

E3 ubiquitin-protein ligase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002674.1
OG0001247
Physical Location & Seq
Reverse (-)
42123 .. 43234
1112 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002674.1_g000015.1.cds

Sequence Viewer

Length: 858 bp
atggataaacatgttgttcctgctcaaccgttagcatcatttgagattgggaggggaccctttggtgatgtctggttagcaacccatcatcagtcaactgaagattatgatgagtatcatgaggtggctgtcaagatgtttcaaccaatcaaagaggacaacgtgaaggctgtgttggataaacttgaagatgttttttataagtgtcaaggggtagaaggtctgtgtcggctacatggaacttcaattatcaatggaaaggtatgcattgtaatgaaattatacgagggatccattggtgacaaaatggctcacctcaaaggagggaagctctcacttcttgatgttttgaggtatggaatcacattggctatggggatttccgaactgcactctagagagatcttggttcttaatctcaaaccttgtaatgttcttttaaatgaaaatgaccaagcaattcttggagattttggtattccttatctattgcttggcattccattggtaagctcagacatgactcggaggattggaactccaaactacatggcacctgaacagtggcaaccagaagtaagaggtccaatatcctttgagactgactcatggggttttgggtgcgtcattgtagaaatgttgactggtgtgcggccttggtgtggaaaatctgttgatgaaatacatttttcagttgttagaaagcaagaaaaaccagacatacctagtggccttcctcctgcaattgagaatattcttcttggctgctttgagtatgacttacggagtcgtccttcaacaatggacatattgaatgctttcaaaaggtatgaatctgtatctgatttgagtttctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0001101 GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0004842 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005769 GO:0005794 GO:0005802 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0006810 GO:0006950 GO:0006952 GO:0007034 GO:0007154 GO:0007165 GO:0008150 GO:0008152 GO:0009719 GO:0009725 GO:0009737 GO:0009738 GO:0009755 GO:0009787 GO:0009788 GO:0009966 GO:0009968 GO:0009987 GO:0010033 GO:0010646 GO:0010648 GO:0012505 GO:0016192 GO:0016197 GO:0016301 GO:0016310 GO:0016567 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0019787 GO:0023051 GO:0023052 GO:0023057 GO:0031410 GO:0031982 GO:0031984 GO:0032446 GO:0032502 GO:0032870 GO:0032940 GO:0033993 GO:0036211 GO:0040007 GO:0042221 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0043621 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044422 GO:0044424 GO:0044431 GO:0044444 GO:0044446 GO:0044464 GO:0045324 GO:0046903 GO:0046907 GO:0048519 GO:0048523 GO:0048583 GO:0048585 GO:0048589 GO:0050789 GO:0050794 GO:0050896 GO:0051179 GO:0051234 GO:0051641 GO:0051649 GO:0051716 GO:0065007 GO:0070647 GO:0070887 GO:0071215 GO:0071229 GO:0071310 GO:0071396 GO:0071495 GO:0071704 GO:0097305 GO:0097306 GO:0097708 GO:0098791 GO:0140096 GO:1901419 GO:1901420 GO:1901564 GO:1901700 GO:1901701 GO:1905957 GO:1905958
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Pkinase_Tyr

Protein Analysis

285

Amino Acids

31.9

Weight (kDa)

5.3

Isoelectric Point (pI)

39.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 201
AccB1I GGYRCC 1 cut(s) 553
AciI CCGC 1 cut(s) 652
AclWI GGATC 2 cut(s) 285, 298
AcuI CTGAAG 1 cut(s) 120
AfiI CCNNNNNNNGG 1 cut(s) 662
AflIII ACRYGT 1 cut(s) 10
AgsI TTSAA 6 cut(s) 143, 188, 246, 798, 814, 823
AjuI GAANNNNNNNTTGG 2 cut(s) 158, 190
AluBI AGCT 2 cut(s) 331, 513
AluI AGCT 2 cut(s) 331, 513
Alw26I GTCTC 1 cut(s) 593
AlwI GGATC 2 cut(s) 285, 298
AoxI GGCC 2 cut(s) 653, 730
ApeKI GCWGC 1 cut(s) 765
Asp700I GAANNNNTTC 1 cut(s) 818
AspS9I GGNCC 2 cut(s) 56, 584
AsuHPI GGTGA 3 cut(s) 77, 305, 311
AvaII GGWCC 2 cut(s) 56, 584
BamHI GGATCC 1 cut(s) 290
BanI GGYRCC 1 cut(s) 553
BbvI GCAGC 1 cut(s) 752
BccI CCATC 1 cut(s) 93
BcoDI GTCTC 1 cut(s) 593
BfaI CTAG 2 cut(s) 396, 726
BglII AGATCT 1 cut(s) 402
BisI GCNGC 2 cut(s) 653, 766
BlsI GCNGC 2 cut(s) 654, 767
Bme18I GGWCC 2 cut(s) 56, 584
BmgT120I GGNCC 2 cut(s) 56, 584
BmiI GGNNCC 4 cut(s) 57, 58, 292, 555
BmsI GCATC 1 cut(s) 44
BplI GAGNNNNNCTC 4 cut(s) 315, 347, 590, 622
BsaBI GATNNNNATC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 656
Bsc4I CCNNNNNNNGG 1 cut(s) 662
Bse1I ACTGG 1 cut(s) 649
Bse8I GATNNNNATC 1 cut(s) 114
BseDI CCNNGG 1 cut(s) 656
BseJI GATNNNNATC 1 cut(s) 114
BseLI CCNNNNNNNGG 1 cut(s) 662
BseMII CTCAG 1 cut(s) 528
BseNI ACTGG 1 cut(s) 649
BseXI GCAGC 1 cut(s) 752
BsgI GTGCAG 1 cut(s) 374
BshFI GGCC 2 cut(s) 655, 732
BshNI GGYRCC 1 cut(s) 553
BslFI GGGAC 1 cut(s) 69
BslI CCNNNNNNNGG 1 cut(s) 662
BsmAI GTCTC 1 cut(s) 593
BsmFI GGGAC 1 cut(s) 69
BsmI GAATGC 2 cut(s) 498, 820
BsnI GGCC 2 cut(s) 655, 732
Bsp143I GATC 2 cut(s) 290, 402
BspACI CCGC 1 cut(s) 652
BspANI GGCC 2 cut(s) 655, 732
BspCNI CTCAG 1 cut(s) 527
BspHI TCATGA 1 cut(s) 118
BspLI GGNNCC 4 cut(s) 57, 58, 292, 555
BspPI GGATC 2 cut(s) 285, 298
BspT107I GGYRCC 1 cut(s) 553
BsrI ACTGG 1 cut(s) 649
BssECI CCNNGG 1 cut(s) 656
BssMI GATC 2 cut(s) 290, 402
BssT1I CCWWGG 1 cut(s) 656
Bst4CI ACNGT 2 cut(s) 30, 564
BstDEI CTNAG 1 cut(s) 514
BstKTI GATC 2 cut(s) 293, 405
BstMAI GTCTC 1 cut(s) 593
BstMBI GATC 2 cut(s) 290, 402
BstNSI RCATGY 1 cut(s) 14
BstV1I GCAGC 1 cut(s) 752
BstX2I RGATCY 2 cut(s) 290, 402
BstYI RGATCY 2 cut(s) 290, 402
BsuRI GGCC 2 cut(s) 655, 732
BtsIMutI CAGTG 1 cut(s) 569
CciI TCATGA 1 cut(s) 118
Cfr13I GGNCC 2 cut(s) 56, 584
CseI GACGC 1 cut(s) 613
CviAII CATG 6 cut(s) 11, 119, 236, 520, 550, 609
DdeI CTNAG 1 cut(s) 514
DpnI GATC 2 cut(s) 292, 404
DpnII GATC 2 cut(s) 290, 402
DraI TTTAAA 1 cut(s) 441
Eco130I CCWWGG 1 cut(s) 656
Eco47I GGWCC 2 cut(s) 56, 584
Eco57I CTGAAG 1 cut(s) 120
EcoO109I RGGNCCY 1 cut(s) 56
EcoT14I CCWWGG 1 cut(s) 656
EcoT22I ATGCAT 1 cut(s) 269
ErhI CCWWGG 1 cut(s) 656
FaeI CATG 6 cut(s) 14, 122, 239, 523, 553, 612
FalI AAGNNNNNCTT 2 cut(s) 447, 479
FaqI GGGAC 1 cut(s) 69
FatI CATG 6 cut(s) 10, 118, 235, 519, 549, 608
Fnu4HI GCNGC 2 cut(s) 653, 766
Fsp4HI GCNGC 2 cut(s) 653, 766
FspBI CTAG 2 cut(s) 396, 726
GluI GCNGC 2 cut(s) 653, 766
HaeIII GGCC 2 cut(s) 655, 732
HgaI GACGC 1 cut(s) 613
Hin1II CATG 6 cut(s) 14, 122, 239, 523, 553, 612
HincII GTYRAC 2 cut(s) 96, 642
HindII GTYRAC 2 cut(s) 96, 642
HinfI GANTC 5 cut(s) 360, 523, 605, 787, 833
HphI GGTGA 3 cut(s) 77, 305, 311
Hpy166II GTNNAC 2 cut(s) 96, 642
Hpy188I TCNGA 5 cut(s) 385, 517, 528, 844, 857
Hpy188III TCNNGA 4 cut(s) 119, 133, 341, 396
Hpy8I GTNNAC 2 cut(s) 96, 642
HpyAV CCTTC 4 cut(s) 160, 212, 743, 804
HpyCH4III ACNGT 2 cut(s) 30, 564
HpyCH4IV ACGT 1 cut(s) 162
HpyCH4V TGCA 3 cut(s) 267, 391, 743
HpyF3I CTNAG 1 cut(s) 514
HpySE526I ACGT 1 cut(s) 162
Hsp92II CATG 6 cut(s) 14, 122, 239, 523, 553, 612
KflI GGGWCCC 1 cut(s) 56
Kzo9I GATC 2 cut(s) 290, 402
LpnPI CCDG 7 cut(s) 33, 58, 570, 585, 630, 729, 753
Lsp1109I GCAGC 1 cut(s) 752
LweI GCATC 1 cut(s) 44
MaeI CTAG 2 cut(s) 396, 726
MaeII ACGT 1 cut(s) 162
MaeIII GTNAC 1 cut(s) 299
MalI GATC 2 cut(s) 292, 404
MboI GATC 2 cut(s) 290, 402
MboII GAAGA 3 cut(s) 113, 200, 749
MfeI CAATTG 1 cut(s) 744
MflI RGATCY 2 cut(s) 290, 402
MluCI AATT 4 cut(s) 246, 278, 459, 744
MlyI GAGTC 3 cut(s) 517, 599, 796
MmeI TCCRAC 1 cut(s) 156
Mph1103I ATGCAT 1 cut(s) 269
MroXI GAANNNNTTC 1 cut(s) 818
MseI TTAA 2 cut(s) 414, 440
MslI CAYNNNNRTG 1 cut(s) 272
MunI CAATTG 1 cut(s) 744
Mva1269I GAATGC 2 cut(s) 498, 820
NdeII GATC 2 cut(s) 290, 402
NlaIII CATG 6 cut(s) 14, 122, 239, 523, 553, 612
NlaIV GGNNCC 4 cut(s) 57, 58, 292, 555
NmuCI GTSAC 1 cut(s) 299
NsiI ATGCAT 1 cut(s) 269
NspI RCATGY 1 cut(s) 14
PagI TCATGA 1 cut(s) 118
PciI ACATGT 1 cut(s) 10
PctI GAATGC 2 cut(s) 498, 820
PdmI GAANNNNTTC 1 cut(s) 818
PfeI GAWTC 2 cut(s) 360, 833
PkrI GCNGC 2 cut(s) 654, 767
PleI GAGTC 3 cut(s) 517, 599, 795
PpsI GAGTC 3 cut(s) 517, 599, 795
PpuMI RGGWCCY 1 cut(s) 56
PscI ACATGT 1 cut(s) 10
PsiI TTATAA 1 cut(s) 201
Psp5II RGGWCCY 1 cut(s) 56
PspN4I GGNNCC 4 cut(s) 57, 58, 292, 555
PspPI GGNCC 2 cut(s) 56, 584
PspPPI RGGWCCY 1 cut(s) 56
PsuI RGATCY 2 cut(s) 290, 402
RseI CAYNNNNRTG 1 cut(s) 272
SaqAI TTAA 2 cut(s) 414, 440
SatI GCNGC 2 cut(s) 653, 766
Sau3AI GATC 2 cut(s) 290, 402
Sau96I GGNCC 2 cut(s) 56, 584
SchI GAGTC 3 cut(s) 517, 599, 796
SfaNI GCATC 1 cut(s) 44
SinI GGWCC 2 cut(s) 56, 584
SmiMI CAYNNNNRTG 1 cut(s) 272
Sse9I AATT 4 cut(s) 246, 278, 459, 744
SsiI CCGC 1 cut(s) 652
SspI AATATT 1 cut(s) 754
SspMI CTAG 2 cut(s) 396, 726
StyI CCWWGG 1 cut(s) 656
TaaI ACNGT 2 cut(s) 30, 564
TaiI ACGT 1 cut(s) 165
TasI AATT 4 cut(s) 246, 278, 459, 744
TauI GCSGC 1 cut(s) 655
TfiI GAWTC 2 cut(s) 360, 833
Tru1I TTAA 2 cut(s) 414, 440
Tru9I TTAA 2 cut(s) 414, 440
TscAI CASTG 1 cut(s) 569
TseFI GTSAC 1 cut(s) 299
TseI GCWGC 1 cut(s) 765
Tsp45I GTSAC 1 cut(s) 299
TspDTI ATGAA 4 cut(s) 290, 459, 693, 846
TspGWI ACGGA 1 cut(s) 799
TspRI CASTG 1 cut(s) 569
VpaK11BI GGWCC 2 cut(s) 56, 584
XbaI TCTAGA 1 cut(s) 395
XceI RCATGY 1 cut(s) 14
XcmI CCANNNNNNNNNTGG 1 cut(s) 461
XmnI GAANNNNTTC 1 cut(s) 818
XspI CTAG 2 cut(s) 396, 726
Zsp2I ATGCAT 1 cut(s) 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.