Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002777.1

Orthogroup ID

OG0002752

Physical Location & Seq

Genomic Coordinates Reverse (-)

12373 .. 17189

Gene Structure 4817 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002777.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1836 bp

atgtggacggacgtgatctcgcaaaaccgacagctgacatggaccccagcgcaccctaacacctatataaatggggtctcaccccacgctcgagccacaagactaccgccaccagaagcacggttgccgccacgccaaccatcagaacacaactccgtgcacgaaacggaacctacgctaccaccaaaatcgagcgagacccaaccgccacaaagacctggtcatccaccaaattggagtccccaagcctggacatcaacaactgacccaacgctaacaccatcctacaagggaagaggagatgacttgcagaggaggctaaaccctaatcgactccgatcactgcggcctctaaattccagtcgctacaagatgactcaagacgtggagatgaaagaggtcccggccccttccaattcagtctcttctactactcccacaactctccactatttgaaggagattgcttcgcttcttgagaccgctgcgtactccaaggaggtcaggcgagttgtccgcgccgttaggctgacgatggcgaagaggcggaagctgagtgtttctgtgctctcggcttttctcagtttcgccttttcgccgggatctgaggctcacacccggttgtcctcctatcttccgaaggacgatgagcatgacatggatgttgatactgcaacctccgcaactctagttcccaagaaacatgcctcgcctgagctagagatttactgctacttgctgctgctgatttttctgattgatcagaaaaaatacagtgaggctaaagcttgtgccacagctggcattgctcgactaaagaacatgaataggagaactattgatgtcctggcatcaaggctctacttctattactctcttagctatgaatatactggtgatcttgcagaaattagagggaaccttcttaatcttcaccggattgcaactttgcgccgtgatgagctgggtcaggagacacttctgaaccttctgcttcgcaattacctgtcatataacctatatgatcaggcagagaaactgaggtccaaggctccccgatttgaggctcactcaaaccagcagttttgtcggtatctcttttatctgggaaagatcagaaccattcagttggagtatactgatgcaaaggagtcccttcttcaagctgctaggaaggcccctgtagctgcccttggctttcgaattcaatgtaacaagtgggcagttattgtacgcttgttgcttggagaaatccctgagaggactgtgtttatgcaaaaaggaatggagaaggctttgaggccatattttgaactaacaaatgctgtgaggattggtgacttggaactattcagaactatagctgacaagttctcgaatgtgtttagctcagacggaacccacaatttgattgtgaggctgcgacataatgttataagaacagggttgcgtaacattagcatctcgtattctcgaatttctctggctgatgttgccaaaaagctgagattggactcccccaaccctgttgctgatgctgaaagtattgtggccaaggcaatccgagatggtgcaattgatgccactctggatcatgcaaatggatatatggtgtcaaaggaaactggagatatctactctacaaatgagccccaagctgcatttgatacaaggattgctttctgcctcaatttgcacaatgatgcagtgcgagcactaaggtttccaccaaattctcacaaggagaaagaaagtgctgagaaaaggagggagagacagcagcaggagcaagagcttgcaaagcatatagctgaggaggatgatgacgaattttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko03050 ko05169 map03050 map05169

Pfam Domains

Protein Families

PCI Rpn3_C

Protein Analysis

611

Amino Acids

69.53

Weight (kDa)

9.31

Isoelectric Point (pI)

48.6

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002752)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G20200 AT1G75990
fragaria_vesca	FvH4_2g15510 FvH4_2g15510
malus_domestica	MD05G1123400.v1.1 MD08G1008900.v1.1 MD10G1126400.v1.1
prunus_persica	Prupe.1G360600_v2.0.a1 Prupe.1G360600_v2.0.a1 Prupe.8G167300_v2.0.a1
pyrus_communis	pycom05g11770 pycom06g20010 pycom10g10860
rosa_chinensis	RchiOBHm_Chr6g0278511
rosa_laevigata	RLG00000007962 RLG00000013222
rosa_multiflora	Rmu_sc0000258.1_g000009 Rmu_sc0002777.1_g000004
rosa_roxburghii	Rroxscaffold_1G00029920 Rroxscaffold_4G00323800 Rroxscaffold_7G00189830 Rroxscaffold_7G00190320
rosa_rugosa	Rorug06G0117600
rosa_samantha	Rh2AG183600 Rh2AG196400 Rh2BG209000 Rh2DG190000 Rh2DG204200 Rh4AG134600 Rh4AG183800 Rh4DG179200 Rh5AG337600 Rh6AG226700 Rh6BG230900 Rh6CG234000 Rh6DG225300
rosa_wichuraiana	Rw0G003080 Rw4G016480 Rw6G019790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	1436
AccI	GTMKAC	1 cut(s)	1136
AccII	CGCG	1 cut(s)	519
AciI	CCGC	8 cut(s)	107, 128, 206, 346, 483, 517, 547, 681
AclWI	GGATC	2 cut(s)	610, 1599
AcoI	YGGCCR	1 cut(s)	1551
AcsI	RAATTY	5 cut(s)	355, 1203, 1476, 1732, 1829
AfaI	GTAC	2 cut(s)	491, 1233
AfiI	CCNNNNNNNGG	2 cut(s)	249, 1063
AgsI	TTSAA	4 cut(s)	457, 1163, 1208, 1313
AjiI	CACGTC	2 cut(s)	13, 385
AjnI	CCWGG	3 cut(s)	217, 248, 846
Alw21I	GWGCWC	3 cut(s)	162, 570, 1717
Alw26I	GTCTC	6 cut(s)	82, 191, 427, 473, 968, 1768
Alw44I	GTGCAC	1 cut(s)	158
AlwI	GGATC	2 cut(s)	610, 1599
Ama87I	CYCGRG	1 cut(s)	90
AoxI	GGCC	5 cut(s)	347, 405, 1176, 1301, 1551
ApaLI	GTGCAC	1 cut(s)	158
ApeKI	GCWGC	8 cut(s)	485, 739, 742, 1166, 1187, 1420, 1658, 1780
ApoI	RAATTY	5 cut(s)	355, 1203, 1476, 1732, 1829
ArsI	GACNNNNNNTTYG	2 cut(s)	205, 237
AspLEI	GCGC	3 cut(s)	52, 521, 954
AspS9I	GGNCC	5 cut(s)	42, 400, 406, 1044, 1177
AsuC2I	CCSGG	3 cut(s)	404, 600, 619
AsuHPI	GGTGA	4 cut(s)	72, 908, 926, 1349
AsuII	TTCGAA	1 cut(s)	1201
AvaI	CYCGRG	1 cut(s)	90
AvaII	GGWCC	3 cut(s)	42, 400, 1044
BaeGI	GKGCMC	1 cut(s)	162
BalI	TGGCCA	1 cut(s)	1553
BanII	GRGCYC	1 cut(s)	1653
Bbv12I	GWGCWC	3 cut(s)	162, 570, 1717
BbvCI	CCTCAGC	1 cut(s)	1812
BbvI	GCAGC	8 cut(s)	472, 726, 729, 1153, 1174, 1407, 1645, 1792
BccI	CCATC	4 cut(s)	148, 289, 529, 1562
BceAI	ACGGC	2 cut(s)	506, 939
BcgI	CGANNNNNNTGC	2 cut(s)	1070, 1104
BciT130I	CCWGG	3 cut(s)	219, 250, 848
BclI	TGATCA	2 cut(s)	760, 1024
BcnI	CCSGG	3 cut(s)	404, 600, 619
BcoDI	GTCTC	6 cut(s)	82, 191, 427, 473, 968, 1768
BfaI	CTAG	3 cut(s)	689, 719, 1170
BfmI	CTRYAG	2 cut(s)	1182, 1359
Bme1390I	CCNGG	6 cut(s)	219, 250, 404, 600, 619, 848
Bme18I	GGWCC	3 cut(s)	42, 400, 1044
BmeT110I	CYCGRG	1 cut(s)	90
BmgBI	CACGTC	2 cut(s)	13, 385
BmgT120I	GGNCC	5 cut(s)	42, 400, 406, 1044, 1177
BmiI	GGNNCC	8 cut(s)	44, 171, 402, 408, 920, 1053, 1179, 1399
BmrFI	CCNGG	6 cut(s)	219, 250, 404, 600, 619, 848
BmsI	GCATC	6 cut(s)	860, 1132, 1470, 1525, 1570, 1693
BplI	GAGNNNNNCTC	2 cut(s)	1055, 1087
BpmI	CTGGAG	1 cut(s)	1647
Bpu10I	CCTNAGC	2 cut(s)	714, 1812
Bpu14I	TTCGAA	1 cut(s)	1201
BpuEI	CTTGAG	2 cut(s)	363, 497
BpuMI	CCSGG	3 cut(s)	404, 600, 619
BsaI	GGTCTC	3 cut(s)	82, 191, 473
BsaJI	CCNNGG	4 cut(s)	495, 1047, 1192, 1554
BsaWI	WCCGGW	1 cut(s)	936
Bsc4I	CCNNNNNNNGG	2 cut(s)	249, 1063
Bse1I	ACTGG	3 cut(s)	360, 898, 1630
Bse3DI	GCAATG	1 cut(s)	804
BseBI	CCWGG	3 cut(s)	219, 250, 848
BseDI	CCNNGG	4 cut(s)	495, 1047, 1192, 1554
BseGI	GGATG	4 cut(s)	223, 281, 667, 1825
BseLI	CCNNNNNNNGG	2 cut(s)	249, 1063
BseMI	GCAATG	1 cut(s)	804
BseNI	ACTGG	3 cut(s)	360, 898, 1630
BseRI	GAGGAG	3 cut(s)	312, 328, 1829
BseSI	GKGCMC	1 cut(s)	162
BseXI	GCAGC	8 cut(s)	472, 726, 729, 1153, 1174, 1407, 1645, 1792
BseYI	CCCAGC	2 cut(s)	46, 964
Bsh1236I	CGCG	1 cut(s)	519
BshFI	GGCC	5 cut(s)	349, 407, 1178, 1303, 1553
BsiHKAI	GWGCWC	3 cut(s)	162, 570, 1717
BsiHKCI	CYCGRG	1 cut(s)	90
BsiSI	CCGG	4 cut(s)	404, 599, 619, 937
BslFI	GGGAC	3 cut(s)	225, 386, 1138
BslI	CCNNNNNNNGG	2 cut(s)	249, 1063
BsmAI	GTCTC	6 cut(s)	82, 191, 427, 473, 968, 1768
BsmFI	GGGAC	3 cut(s)	225, 386, 1138
BsnI	GGCC	5 cut(s)	349, 407, 1178, 1303, 1553
Bso31I	GGTCTC	3 cut(s)	82, 191, 473
BsoBI	CYCGRG	1 cut(s)	90
Bsp119I	TTCGAA	1 cut(s)	1201
Bsp1286I	GDGCHC	4 cut(s)	162, 570, 1653, 1717
Bsp143I	GATC	8 cut(s)	15, 338, 602, 760, 898, 1024, 1113, 1591
BspACI	CCGC	8 cut(s)	107, 128, 206, 346, 483, 517, 547, 681
BspANI	GGCC	5 cut(s)	349, 407, 1178, 1303, 1553
BspFNI	CGCG	1 cut(s)	519
BspLI	GGNNCC	8 cut(s)	44, 171, 402, 408, 920, 1053, 1179, 1399
BspPI	GGATC	2 cut(s)	610, 1599
BspT104I	TTCGAA	1 cut(s)	1201
BspTNI	GGTCTC	3 cut(s)	82, 191, 473
BsrDI	GCAATG	1 cut(s)	804
BsrI	ACTGG	3 cut(s)	360, 898, 1630
BssECI	CCNNGG	4 cut(s)	495, 1047, 1192, 1554
BssMI	GATC	8 cut(s)	15, 338, 602, 760, 898, 1024, 1113, 1591
BssNAI	GTATAC	1 cut(s)	1137
BssT1I	CCWWGG	4 cut(s)	495, 1047, 1192, 1554
Bst1107I	GTATAC	1 cut(s)	1137
Bst2UI	CCWGG	3 cut(s)	219, 250, 848
Bst4CI	ACNGT	3 cut(s)	123, 776, 1267
Bst6I	CTCTTC	3 cut(s)	289, 430, 536
BstAPI	GCANNNNNTGC	1 cut(s)	1580
BstBI	TTCGAA	1 cut(s)	1201
BstC8I	GCNNGC	3 cut(s)	802, 1713, 1797
BstF5I	GGATG	4 cut(s)	223, 281, 667, 1825
BstFNI	CGCG	1 cut(s)	519
BstHHI	GCGC	3 cut(s)	52, 521, 954
BstKTI	GATC	8 cut(s)	18, 341, 605, 763, 901, 1027, 1116, 1594
BstMAI	GTCTC	6 cut(s)	82, 191, 427, 473, 968, 1768
BstMBI	GATC	8 cut(s)	15, 338, 602, 760, 898, 1024, 1113, 1591
BstNI	CCWGG	3 cut(s)	219, 250, 848
BstNSI	RCATGY	1 cut(s)	707
BstSCI	CCNGG	6 cut(s)	217, 248, 402, 598, 617, 846
BstSFI	CTRYAG	2 cut(s)	1182, 1359
BstSLI	GKGCMC	1 cut(s)	162
BstUI	CGCG	1 cut(s)	519
BstV1I	GCAGC	8 cut(s)	472, 726, 729, 1153, 1174, 1407, 1645, 1792
BstX2I	RGATCY	1 cut(s)	602
BstXI	CCANNNNNNTGG	2 cut(s)	234, 1129
BstYI	RGATCY	1 cut(s)	602
BstZ17I	GTATAC	1 cut(s)	1137
BsuRI	GGCC	5 cut(s)	349, 407, 1178, 1303, 1553
BtrI	CACGTC	2 cut(s)	13, 385
BtsCI	GGATG	4 cut(s)	223, 281, 667, 1825
BtsI	GCAGTG	2 cut(s)	341, 1713
BtsIMutI	CAGTG	3 cut(s)	341, 781, 1713
Cac8I	GCNNGC	3 cut(s)	802, 1713, 1797
CfoI	GCGC	3 cut(s)	52, 521, 954
Cfr13I	GGNCC	5 cut(s)	42, 400, 406, 1044, 1177
CsiI	ACCWGGT	1 cut(s)	217
Csp6I	GTAC	2 cut(s)	490, 1232
CviAII	CATG	6 cut(s)	39, 653, 658, 704, 823, 1595
CviQI	GTAC	2 cut(s)	490, 1232
DpnI	GATC	8 cut(s)	17, 340, 604, 762, 900, 1026, 1115, 1593
DpnII	GATC	8 cut(s)	15, 338, 602, 760, 898, 1024, 1113, 1591
EaeI	YGGCCR	1 cut(s)	1551
Eam1104I	CTCTTC	3 cut(s)	289, 430, 536
EarI	CTCTTC	3 cut(s)	289, 430, 536
EciI	GGCGGA	1 cut(s)	562
Eco130I	CCWWGG	4 cut(s)	495, 1047, 1192, 1554
Eco24I	GRGCYC	1 cut(s)	1653
Eco31I	GGTCTC	3 cut(s)	82, 191, 473
Eco32I	GATATC	1 cut(s)	1633
Eco47I	GGWCC	3 cut(s)	42, 400, 1044
Eco88I	CYCGRG	1 cut(s)	90
EcoO109I	RGGNCCY	2 cut(s)	400, 1177
EcoRI	GAATTC	1 cut(s)	1203
EcoRII	CCWGG	3 cut(s)	217, 248, 846
EcoRV	GATATC	1 cut(s)	1633
EcoT14I	CCWWGG	4 cut(s)	495, 1047, 1192, 1554
EcoT38I	GRGCYC	1 cut(s)	1653
ErhI	CCWWGG	4 cut(s)	495, 1047, 1192, 1554
FaeI	CATG	6 cut(s)	42, 656, 661, 707, 826, 1598
FalI	AAGNNNNNCTT	2 cut(s)	1663, 1695
FaqI	GGGAC	3 cut(s)	225, 386, 1138
FatI	CATG	6 cut(s)	38, 652, 657, 703, 822, 1594
FbaI	TGATCA	2 cut(s)	760, 1024
FblI	GTMKAC	1 cut(s)	1136
FokI	GGATG	4 cut(s)	210, 268, 674, 1832
FriOI	GRGCYC	1 cut(s)	1653
FspBI	CTAG	3 cut(s)	689, 719, 1170
GlaI	GCGC	3 cut(s)	51, 520, 953
GsaI	CCCAGC	2 cut(s)	50, 968
GsuI	CTGGAG	1 cut(s)	1647
HaeIII	GGCC	5 cut(s)	349, 407, 1178, 1303, 1553
HapII	CCGG	4 cut(s)	404, 599, 619, 937
HhaI	GCGC	3 cut(s)	52, 521, 954
Hin1II	CATG	6 cut(s)	42, 656, 661, 707, 826, 1598
Hin6I	GCGC	3 cut(s)	50, 519, 952
HinP1I	GCGC	3 cut(s)	50, 519, 952
HindIII	AAGCTT	1 cut(s)	786
HinfI	GANTC	5 cut(s)	238, 333, 376, 1151, 1514
HpaII	CCGG	4 cut(s)	404, 599, 619, 937
HphI	GGTGA	4 cut(s)	72, 908, 926, 1349
Hpy166II	GTNNAC	3 cut(s)	6, 160, 1137
Hpy188III	TCNNGA	6 cut(s)	380, 476, 971, 1375, 1473, 1589
Hpy8I	GTNNAC	3 cut(s)	6, 160, 1137
HpyAV	CCTTC	8 cut(s)	420, 451, 634, 932, 998, 1166, 1168, 1285
HpyCH4III	ACNGT	3 cut(s)	123, 776, 1267
HpyCH4IV	ACGT	2 cut(s)	12, 384
HpySE526I	ACGT	2 cut(s)	12, 384
Hsp92II	CATG	6 cut(s)	42, 656, 661, 707, 826, 1598
HspAI	GCGC	3 cut(s)	50, 519, 952
Ksp22I	TGATCA	2 cut(s)	760, 1024
Kzo9I	GATC	8 cut(s)	15, 338, 602, 760, 898, 1024, 1113, 1591
LmnI	GCTCC	2 cut(s)	1057, 1786
Lsp1109I	GCAGC	8 cut(s)	472, 726, 729, 1153, 1174, 1407, 1645, 1792
LweI	GCATC	6 cut(s)	860, 1132, 1470, 1525, 1570, 1693
MabI	ACCWGGT	1 cut(s)	217
MaeI	CTAG	3 cut(s)	689, 719, 1170
MaeII	ACGT	2 cut(s)	12, 384
MaeIII	GTNAC	3 cut(s)	1211, 1337, 1451
MalI	GATC	8 cut(s)	17, 340, 604, 762, 900, 1026, 1115, 1593
MboI	GATC	8 cut(s)	15, 338, 602, 760, 898, 1024, 1113, 1591
MboII	GAAGA	6 cut(s)	306, 417, 553, 626, 923, 1151
MfeI	CAATTG	1 cut(s)	1575
MflI	RGATCY	1 cut(s)	602
MhlI	GDGCHC	4 cut(s)	162, 570, 1653, 1717
MlsI	TGGCCA	1 cut(s)	1553
MluNI	TGGCCA	1 cut(s)	1553
MlyI	GAGTC	5 cut(s)	247, 327, 370, 1160, 1508
MmeI	TCCRAC	1 cut(s)	1110
Mox20I	TGGCCA	1 cut(s)	1553
MscI	TGGCCA	1 cut(s)	1553
MseI	TTAA	1 cut(s)	927
MslI	CAYNNNNRTG	2 cut(s)	1599, 1701
Msp20I	TGGCCA	1 cut(s)	1553
MspA1I	CMGCKG	3 cut(s)	34, 485, 800
MspI	CCGG	4 cut(s)	404, 599, 619, 937
MspR9I	CCNGG	6 cut(s)	219, 250, 404, 600, 619, 848
MunI	CAATTG	1 cut(s)	1575
MvaI	CCWGG	3 cut(s)	219, 250, 848
MvnI	CGCG	1 cut(s)	519
NciI	CCSGG	3 cut(s)	404, 600, 619
NdeII	GATC	8 cut(s)	15, 338, 602, 760, 898, 1024, 1113, 1591
NlaIII	CATG	6 cut(s)	42, 656, 661, 707, 826, 1598
NlaIV	GGNNCC	8 cut(s)	44, 171, 402, 408, 920, 1053, 1179, 1399
NmeAIII	GCCGAG	1 cut(s)	551
NmuCI	GTSAC	1 cut(s)	1337
NspI	RCATGY	1 cut(s)	707
NspV	TTCGAA	1 cut(s)	1201
PaeR7I	CTCGAG	1 cut(s)	90
PflFI	GACNNNGTC	1 cut(s)	219
PleI	GAGTC	5 cut(s)	246, 327, 370, 1159, 1508
PpsI	GAGTC	5 cut(s)	246, 327, 370, 1159, 1508
PpuMI	RGGWCCY	1 cut(s)	400
PsiI	TTATAA	1 cut(s)	1436
Psp5II	RGGWCCY	1 cut(s)	400
Psp6I	CCWGG	3 cut(s)	217, 248, 846
PspFI	CCCAGC	2 cut(s)	46, 964
PspGI	CCWGG	3 cut(s)	217, 248, 846
PspN4I	GGNNCC	8 cut(s)	44, 171, 402, 408, 920, 1053, 1179, 1399
PspPI	GGNCC	5 cut(s)	42, 400, 406, 1044, 1177
PspPPI	RGGWCCY	1 cut(s)	400
PspXI	VCTCGAGB	1 cut(s)	90
PsrI	GAACNNNNNNTAC	2 cut(s)	162, 194
PsuI	RGATCY	1 cut(s)	602
PsyI	GACNNNGTC	1 cut(s)	219
PvuII	CAGCTG	2 cut(s)	34, 800
RsaI	GTAC	2 cut(s)	491, 1233
RsaNI	GTAC	2 cut(s)	490, 1232
RseI	CAYNNNNRTG	2 cut(s)	1599, 1701
SaqAI	TTAA	1 cut(s)	927
Sau3AI	GATC	8 cut(s)	15, 338, 602, 760, 898, 1024, 1113, 1591
Sau96I	GGNCC	5 cut(s)	42, 400, 406, 1044, 1177
SchI	GAGTC	5 cut(s)	247, 327, 370, 1160, 1508
ScrFI	CCNGG	6 cut(s)	219, 250, 404, 600, 619, 848
SduI	GDGCHC	4 cut(s)	162, 570, 1653, 1717
SexAI	ACCWGGT	1 cut(s)	217
SfaNI	GCATC	6 cut(s)	860, 1132, 1470, 1525, 1570, 1693
SfcI	CTRYAG	2 cut(s)	1182, 1359
Sfr274I	CTCGAG	1 cut(s)	90
SfuI	TTCGAA	1 cut(s)	1201
SinI	GGWCC	3 cut(s)	42, 400, 1044
SlaI	CTCGAG	1 cut(s)	90
SmiMI	CAYNNNNRTG	2 cut(s)	1599, 1701
SmlI	CTYRAG	3 cut(s)	90, 378, 476
SmoI	CTYRAG	3 cut(s)	90, 378, 476
SsiI	CCGC	8 cut(s)	107, 128, 206, 346, 483, 517, 547, 681
SspMI	CTAG	3 cut(s)	689, 719, 1170
StyD4I	CCNGG	6 cut(s)	217, 248, 402, 598, 617, 846
StyI	CCWWGG	4 cut(s)	495, 1047, 1192, 1554
TaaI	ACNGT	3 cut(s)	123, 776, 1267
TaiI	ACGT	2 cut(s)	15, 387
TaqI	TCGA	7 cut(s)	91, 191, 331, 811, 1201, 1376, 1474
TauI	GCSGC	2 cut(s)	130, 349
Tru1I	TTAA	1 cut(s)	927
Tru9I	TTAA	1 cut(s)	927
TscAI	CASTG	3 cut(s)	348, 781, 1713
TseFI	GTSAC	1 cut(s)	1337
TseI	GCWGC	8 cut(s)	485, 739, 742, 1166, 1187, 1420, 1658, 1780
Tsp45I	GTSAC	1 cut(s)	1337
TspDTI	ATGAA	3 cut(s)	407, 839, 900
TspGWI	ACGGA	4 cut(s)	23, 145, 182, 1410
TspRI	CASTG	3 cut(s)	348, 781, 1713
Tth111I	GACNNNGTC	1 cut(s)	219
VneI	GTGCAC	1 cut(s)	158
VpaK11BI	GGWCC	3 cut(s)	42, 400, 1044
XapI	RAATTY	5 cut(s)	355, 1203, 1476, 1732, 1829
XceI	RCATGY	1 cut(s)	707
XhoI	CTCGAG	1 cut(s)	90
XmiI	GTMKAC	1 cut(s)	1136
XspI	CTAG	3 cut(s)	689, 719, 1170

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.