Rh5AG337600

26S proteasome non-ATPase regulatory subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
54449987 .. 54450500
514 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG337600.1

Sequence Viewer

Length: 321 bp
ATGGCGAAGAGGCGGAAGCTGAGTGTTTCTGTGCTCTCGGCGTTTCTCAGTTTCGCCTTTTCGCTGGGATCTAAGGCTTACACCAAGCTACACAATTATATTGCAAAGAAGATACACCAAGCTACACAATTATATTGCAAAGAAGATAGGTTGTCCTATCTTCCGAAGGATGTTGACACTGCAACTTCTGCCACTCAAGTTCCCAAGAAACATGCCTCGCCTGAGCTAGAGATTTACTGCTACTTGCTGGTGCTGATTTTTCTGATTGATCAGAAAGAATACAGTGAGGCTAAAGCTTGTGCCACAGCTGGCATTGCTTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

11.86

Weight (kDa)

9.28

Isoelectric Point (pI)

32.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPR_PSMD3_N PF25573 3 - 103 9e-13 PSMD3-like, N-terminal TPR repeats
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 13
AclWI GGATC 1 cut(s) 76
AluBI AGCT 6 cut(s) 19, 88, 122, 226, 296, 308
AluI AGCT 6 cut(s) 19, 88, 122, 226, 296, 308
Alw21I GWGCWC 1 cut(s) 36
AlwI GGATC 1 cut(s) 76
Bbv12I GWGCWC 1 cut(s) 36
BclI TGATCA 1 cut(s) 268
BfaI CTAG 1 cut(s) 227
Bpu10I CCTNAGC 1 cut(s) 222
BpuEI CTTGAG 1 cut(s) 180
Bse3DI GCAATG 1 cut(s) 312
BseGI GGATG 1 cut(s) 175
BseMI GCAATG 1 cut(s) 312
BseMII CTCAG 3 cut(s) 11, 61, 213
BseYI CCCAGC 1 cut(s) 64
BsiHKAI GWGCWC 1 cut(s) 36
Bsp1286I GDGCHC 1 cut(s) 36
Bsp143I GATC 2 cut(s) 68, 268
BspACI CCGC 1 cut(s) 13
BspCNI CTCAG 3 cut(s) 12, 60, 214
BspPI GGATC 1 cut(s) 76
BsrDI GCAATG 1 cut(s) 312
BssMI GATC 2 cut(s) 68, 268
Bst4CI ACNGT 1 cut(s) 284
Bst6I CTCTTC 1 cut(s) 2
BstAPI GCANNNNNTGC 1 cut(s) 188
BstC8I GCNNGC 1 cut(s) 310
BstDEI CTNAG 4 cut(s) 20, 47, 72, 222
BstF5I GGATG 1 cut(s) 175
BstKTI GATC 2 cut(s) 71, 271
BstMBI GATC 2 cut(s) 68, 268
BstMWI GCNNNNNNNGC 2 cut(s) 188, 314
BstNSI RCATGY 1 cut(s) 215
BstX2I RGATCY 1 cut(s) 68
BstYI RGATCY 1 cut(s) 68
BtsCI GGATG 1 cut(s) 175
BtsI GCAGTG 1 cut(s) 177
BtsIMutI CAGTG 2 cut(s) 177, 289
Cac8I GCNNGC 1 cut(s) 310
CviAII CATG 1 cut(s) 212
CviJI RGCY 8 cut(s) 19, 77, 88, 122, 226, 290, 296, 308
CviKI_1 RGCY 8 cut(s) 19, 77, 88, 122, 226, 290, 296, 308
DdeI CTNAG 4 cut(s) 20, 47, 72, 222
DpnI GATC 2 cut(s) 70, 270
DpnII GATC 2 cut(s) 68, 268
Eam1104I CTCTTC 1 cut(s) 2
EarI CTCTTC 1 cut(s) 2
EciI GGCGGA 1 cut(s) 28
FaeI CATG 1 cut(s) 215
FaiI YATR 3 cut(s) 99, 133, 213
FatI CATG 1 cut(s) 211
FbaI TGATCA 1 cut(s) 268
FokI GGATG 1 cut(s) 182
FspBI CTAG 1 cut(s) 227
GsaI CCCAGC 1 cut(s) 68
Hin1II CATG 1 cut(s) 215
HincII GTYRAC 1 cut(s) 175
HindII GTYRAC 1 cut(s) 175
HindIII AAGCTT 1 cut(s) 294
Hpy166II GTNNAC 1 cut(s) 175
Hpy188I TCNGA 3 cut(s) 165, 264, 273
Hpy8I GTNNAC 1 cut(s) 175
HpyAV CCTTC 1 cut(s) 160
HpyCH4III ACNGT 1 cut(s) 284
HpyCH4V TGCA 3 cut(s) 104, 138, 182
HpyF10VI GCNNNNNNNGC 2 cut(s) 188, 314
HpyF3I CTNAG 4 cut(s) 20, 47, 72, 222
Hsp92II CATG 1 cut(s) 215
Ksp22I TGATCA 1 cut(s) 268
Kzo9I GATC 2 cut(s) 68, 268
LpnPI CCDG 4 cut(s) 50, 233, 234, 294
MaeI CTAG 1 cut(s) 227
MalI GATC 2 cut(s) 70, 270
MboI GATC 2 cut(s) 68, 268
MboII GAAGA 4 cut(s) 19, 121, 152, 155
MflI RGATCY 1 cut(s) 68
MhlI GDGCHC 1 cut(s) 36
MluCI AATT 2 cut(s) 94, 128
MnlI CCTC 3 cut(s) 3, 226, 280
MspA1I CMGCKG 1 cut(s) 308
MwoI GCNNNNNNNGC 2 cut(s) 188, 314
NdeII GATC 2 cut(s) 68, 268
NlaIII CATG 1 cut(s) 215
NmeAIII GCCGAG 1 cut(s) 17
NspI RCATGY 1 cut(s) 215
PspFI CCCAGC 1 cut(s) 64
PsuI RGATCY 1 cut(s) 68
PvuII CAGCTG 1 cut(s) 308
Sau3AI GATC 2 cut(s) 68, 268
SduI GDGCHC 1 cut(s) 36
SetI ASST 7 cut(s) 21, 90, 124, 152, 228, 298, 310
SmlI CTYRAG 1 cut(s) 195
SmoI CTYRAG 1 cut(s) 195
Sse9I AATT 2 cut(s) 94, 128
SsiI CCGC 1 cut(s) 13
SspMI CTAG 1 cut(s) 227
TaaI ACNGT 1 cut(s) 284
TasI AATT 2 cut(s) 94, 128
TscAI CASTG 2 cut(s) 184, 289
TspRI CASTG 2 cut(s) 184, 289
XceI RCATGY 1 cut(s) 215
XspI CTAG 1 cut(s) 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.