Rh2DG204200

26S proteasome non-ATPase regulatory subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0002752
Physical Location & Seq
Forward (+)
19031844 .. 19033523
1680 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG204200.1

Sequence Viewer

Length: 282 bp
ATGGACGATGAGCATGACATGGATGTTGATACCGCAACTTCTGCTACTCAAGTTCCCAAGAAACATGCCTCGCCTGAGCTAGATATTTACTGCTACTTGCTGGTGCTGATTTTTCTGATTGATAAGAAAGAATACAATGAGGCTAAAGCTTGTGCCACAGCTGGCATTGCTCGACTAAAGAACATGAATAGGAGAACTGTTGATGTCCTGGCATCAAGGCTTTACTTCTATCACTCTCTTAGCTATGAATATACAGGTGATCTCGCAGAAATTAGAGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464
KEGG Pathways
Metabolic & Signaling
ko03050 ko05169 map03050 map05169
Pfam Domains
Protein Families
PCI Rpn3_C

Protein Analysis

93

Amino Acids

10.61

Weight (kDa)

5.22

Isoelectric Point (pI)

24.85

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPR_PSMD3_N PF25573 8 - 93 2e-27 PSMD3-like, N-terminal TPR repeats
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 33
AjnI CCWGG 1 cut(s) 207
AluBI AGCT 4 cut(s) 79, 149, 161, 243
AluI AGCT 4 cut(s) 79, 149, 161, 243
AsuHPI GGTGA 1 cut(s) 269
BciT130I CCWGG 1 cut(s) 209
BfaI CTAG 1 cut(s) 80
Bme1390I CCNGG 1 cut(s) 209
BmrFI CCNGG 1 cut(s) 209
BmsI GCATC 1 cut(s) 221
Bpu10I CCTNAGC 1 cut(s) 75
BpuEI CTTGAG 1 cut(s) 33
Bse3DI GCAATG 1 cut(s) 165
BseBI CCWGG 1 cut(s) 209
BseGI GGATG 1 cut(s) 28
BseMI GCAATG 1 cut(s) 165
BseMII CTCAG 1 cut(s) 66
Bsp143I GATC 1 cut(s) 259
BspACI CCGC 1 cut(s) 33
BspCNI CTCAG 1 cut(s) 67
BsrDI GCAATG 1 cut(s) 165
BssMI GATC 1 cut(s) 259
Bst2UI CCWGG 1 cut(s) 209
Bst4CI ACNGT 1 cut(s) 199
BstAPI GCANNNNNTGC 1 cut(s) 41
BstC8I GCNNGC 1 cut(s) 163
BstDEI CTNAG 2 cut(s) 75, 239
BstF5I GGATG 1 cut(s) 28
BstKTI GATC 1 cut(s) 262
BstMBI GATC 1 cut(s) 259
BstMWI GCNNNNNNNGC 2 cut(s) 41, 167
BstNI CCWGG 1 cut(s) 209
BstNSI RCATGY 1 cut(s) 68
BstSCI CCNGG 1 cut(s) 207
BtsCI GGATG 1 cut(s) 28
Cac8I GCNNGC 1 cut(s) 163
CviAII CATG 4 cut(s) 14, 19, 65, 184
CviJI RGCY 6 cut(s) 79, 143, 149, 161, 220, 243
CviKI_1 RGCY 6 cut(s) 79, 143, 149, 161, 220, 243
DdeI CTNAG 2 cut(s) 75, 239
DpnI GATC 1 cut(s) 261
DpnII GATC 1 cut(s) 259
EcoRII CCWGG 1 cut(s) 207
FaeI CATG 4 cut(s) 17, 22, 68, 187
FaiI YATR 6 cut(s) 15, 20, 66, 185, 246, 252
FatI CATG 4 cut(s) 13, 18, 64, 183
FokI GGATG 1 cut(s) 35
FspBI CTAG 1 cut(s) 80
Hin1II CATG 4 cut(s) 17, 22, 68, 187
HindIII AAGCTT 1 cut(s) 147
HphI GGTGA 1 cut(s) 269
Hpy188I TCNGA 1 cut(s) 117
HpyCH4III ACNGT 1 cut(s) 199
HpyF10VI GCNNNNNNNGC 2 cut(s) 41, 167
HpyF3I CTNAG 2 cut(s) 75, 239
Hsp92II CATG 4 cut(s) 17, 22, 68, 187
Kzo9I GATC 1 cut(s) 259
LpnPI CCDG 6 cut(s) 86, 87, 147, 194, 221, 240
LweI GCATC 1 cut(s) 221
MaeI CTAG 1 cut(s) 80
MalI GATC 1 cut(s) 261
MboI GATC 1 cut(s) 259
MluCI AATT 1 cut(s) 270
MnlI CCTC 3 cut(s) 79, 133, 269
MspA1I CMGCKG 1 cut(s) 161
MspR9I CCNGG 1 cut(s) 209
MvaI CCWGG 1 cut(s) 209
MwoI GCNNNNNNNGC 2 cut(s) 41, 167
NdeII GATC 1 cut(s) 259
NlaIII CATG 4 cut(s) 17, 22, 68, 187
NspI RCATGY 1 cut(s) 68
Psp6I CCWGG 1 cut(s) 207
PspGI CCWGG 1 cut(s) 207
PvuII CAGCTG 1 cut(s) 161
Sau3AI GATC 1 cut(s) 259
ScrFI CCNGG 1 cut(s) 209
SetI ASST 5 cut(s) 81, 151, 163, 245, 259
SfaNI GCATC 1 cut(s) 221
SmlI CTYRAG 1 cut(s) 48
SmoI CTYRAG 1 cut(s) 48
Sse9I AATT 1 cut(s) 270
SsiI CCGC 1 cut(s) 33
SspMI CTAG 1 cut(s) 80
StyD4I CCNGG 1 cut(s) 207
TaaI ACNGT 1 cut(s) 199
TaqI TCGA 1 cut(s) 172
TasI AATT 1 cut(s) 270
TspDTI ATGAA 2 cut(s) 200, 261
XceI RCATGY 1 cut(s) 68
XspI CTAG 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.